PHASTEST

Remember Me

Submission Results

Sequence Name: Not Available

GenBank Accession Number: NZ_JAHZTX000000000.1

Download Results: NZ_JAHZTX000000000.1.PHASTEST.zip

Region Summary
Phage Genes
Bacterial Genes
Genome Viewer 2.0

gi|00000000|ref|NC_000000| Streptococcus oralis strain E665 NODE_722_length_226_cov_0.655629, 2101270, gc%: 41.11%

Download summary as .txt file:summary.txt

Total:1 prophage regions have been identified, of which 0 regions are intact, 1 regions are incomplete, and 0 regions are questionable.

Region	Region Length	Completeness	Score	# Total Proteins	Region Position	Most Common Phage	GC %	Details
contig,5,at,1466582
1	13.6Kb	incomplete	50	21	69544-83144	PHAGE_Lactoc_bIL311_NC_002670(2)	34.03%	Show

Region DNA

>1	 contig,5,at,1466582:69544-83144
AGTGGGCTTTTTGCTTTGTCTTAAAATGTTGATTTCTGGGTTTGTTCAGTTATTTGTTCA
GTTATAAACTTTTTAGTGCAGTTTCATAGAATGAGACTGCTTTTTTTGCGTTCTCTTTTG
AGAGGTGACTGTATATATCCATGGTCATAGATAATTGGGAATGTCCTAAACGGTGCTGAA
GTTCCTTGTAGGGTATTCCAGAGTTAAGCAATAAACTAGCGTGTGTATGTCTGAAGCCAT
GAAAACCTATATTAGTGACGTTTGCCCGTTTAAAGTGGGTTCTTAACCTAGTATGTAAGG
TTCGATTATTGGGGTACTCATTTATGAAGTCAGAAAAGACTACAGTTTCAGAGCGCCCAA
GTTGCCAAGCTTCTTGTACTTGTCTATGTTTGTACTGCTTCAGCATACTAACAGTCGCTT
GATCTATATCGATATCACGATAGCTAGATTTTGATTTAGGACTATTGAGTTCTTGATTAT
AGTTTAGTGTTTTTGTGATATGCACAATGGCATTATCTAGGTCAATATCAGACCAGGACA
AGGCTAAAGCTTCATTGATACGACAACCAGTAGCAAGCAAAAACTTATAAAGTGTAATCT
CATAATAATAGCGATACCTACTTACATCCAGAGTATCTAAGTATTGAAGAAATCTTTTTA
AGTCTTCATTATCAAAATGCTTTACTTTTTCTCGCTTTTCTTTTTGTGTGTTGCGAGGTA
ATATTACCTCACGAGCAGGATTAAACGGTATAGCTTGCATAACTACACCATACTGCAAAA
TACGCTTATTTAAAGCGTGTAAGCTATCGTAGTATAAAAAAGCACCTTCTTCCCCTTTAT
TGGTTTTGTCAGCAAGTTTATTGACTACATTTTGAATAAGTGGAGTAGTTAGTTTATCCA
ACTTATAAGAGCCAAATAAAGGTAAGATATGGTTATCTAGCAGTCTTCTAACGTTTAATT
GTGTGTTAGGTTTTACTGTATGCTTGTAACTTTCCCACCATAAGGAAGCTAATTCCTTGT
AAGTAGTAATATTTGCAGCCTGGAATCTAGTAGATCCATTTTGTAAAAAAGCAATTTCAG
CTTCTTTTGTCTTTTGCTTAACTTCTTTTTTTGTCCTTCCTGTTATGCTTGTCTTTACAT
CTTTTCCAGTGACTTTATCAACACCAAGATAGACATTAGCACGATATACTATTGAACCGT
CTTTTTTTGTGATTTGTTTTATTTGCATAGTATTCCTTTCCATCAGCAGGCAAGCAATTA
GAAAAGGTTTTGAGTTTATACTATGCTAGGAGCTACGAGAACTCCTCTATTTTCGATTTT
AAGAGGACTATCAGTAAAATAACCAGATAGGAAAATAAAGCGATTATGGAGCTTATAAAG
GATATTAATTAGATAATCTTCTCAAATACCATTGTGGCTTGAATGCGGTCACCACCGCCT
AAACCTTTGCTTCCACCATTGGCGGTTGTGATTGTATGCAGGCGATAACCTTTAGAAGCT
TGTTTATTGATAACATCTTCTAATTCTGTAAGGTTTCCTGATCCAGTGCCGAAAAACTTT
TCTTTTAAAGTTACCTGAAGGACAACGTAGTGTAGTCCATTTACTCCAGATGCAGTAGAA
AAACTACCTTCTTGTTTTACAGTGTCAAAAAATCCCATGGGGCTTACTCCTTTTATTATG
TTAGTAATTGATAAAACTTAGTCAATAATTTTTTTGTATTGTTTGAATTGTTCTTCTATA
GTGTCATCCTTGTATAGTGAATTAGTTACTTTAAGTATGTTTTCAGTTGGGATATAGTTT
GATTTTACAGAGTACATAGATTTCAGTTTTTCTGTGTCCGTTTCTGTATATCTGTAATTA
GAATTAAGTTCAGATAGATCTTGCAATTGATAAAAAATCATTTCTATTTGCTTATCAGAT
AAAACAATATCACTTAGAGAAATATAGTCTAAAAATCTAACAAATGCCTCTTTGTTCATC
TTTTCCATAACATTATTATGGAAATCAATCTCATATTCTGTAACATCATCATTATTGAAC
CCCAATAGATATCCAACACTTACCCCGAAAATATCCGCTAATTGCTGGGCTTTTTCTGAT
TTTATTTGGTGTTCGCCTTTTTCCCAGTTTAAAATTGTCAGTTTTGATACTCCGATTTGT
TTAGCAAGTTCCTGTTGTGTCAGTTTTCTCTCTTGCCTTAATTCTTTCAATCTACTCATT
TTTACACTACCTTTCCTCTTTATTCTACCACTATTTTGAAGATAAGTATAGAAAATTTAT
AATTTAATTTAATTTTTTCTCTTGACAAGTAAAGAAAGTTATACTAGAATGTAATCGTAG
CAAGAAAAAGTATAGAAAACTATACCTTGTAATTCAACCAGATAAAACTCCATCTATCTA
CTACTTTTCACGTCTGGTTCGAAAATTTTAAAAAAGGAGGTGTTTAAATGCTTATAACTG
AGAGTATGGCAGAACAGGTAAGAGTCAAGCGTGCAGTTAATCGTCTTACGATGAAGGAAC
TAGCACAAAAACTAGGTACAACATACTCTACCTTACGTCAGGTAGAACAGGGCGATTATG
ATGCCCCGAGACGAATATATCAATCAGTTAGTGAGTGGCTTGCTGAAGATTACTAGAAAG
GGGCATAAGACAGAGTCTAGAAATATTTTGCTTGCTACCTATGGCAGTATCAAGGGTTTG
TAGGGGTTTATTCTCTCCTAAATTTTCCCTACCTCAATGATTTACTTTGGTACTGTTTTA
GGTGGCAAGCACGAGCAACAAGAAGAAAGGAGCGAACCAATGGAATTGGTTTATATGGAC
GGCAAGAAAGAGCCGTATACACTGAGCAGTATCGTAGCAGAATGCACTGGATTGCAACAT
CACACAATAACCAAGACAATCCGCAAACATCAAGTAAGGTTTGAACGGTTCGGAAAGGTT
GGATTTAAAATCCAAGCTATGGAAAGTGGCCAGAATACTAAGGATTATATTTTGAATGAG
CAACAAGCGACCTTGTTAGTTACATTCTTAAAAAATACTGAGCAAGTGGCCAACTTCAAA
ACCAATCTTGTCAAAGCCTTCTTTGAAATGCGTGATGAACTTTCTAAACGCTATCTTCAA
AGAGAACTGGAAAAGCCAAAGCGTAAAAGTTTAACTGAAGCTATTCAAACATGGGAGAAA
GCCCCCAAGCATGCCTATAGTACACTTACAAACTTACTACTAAAGGGAGTGACAGGGAAG
AATAAAGCGCAACTCATGAAGGAGCGAGAAAGTAAGAACGGTATCGATGGCTTGACAAGT
GTAGAACTGACAAACTACCAACGTTTGGAAGATATGGCAATAGCTATGATTAATTTGAAT
AGGGGGTATTCAGAAATTAAGGAATTAATTTTTAAAGTATAGGAGTATAGAAAATGGAAA
ATGATTTTAAGACAGTTACAAATGCCAAAGGGTTAGAAATTCCCAAGTATTCCAAGGATT
TTAAAAAGCTAGTTGAGAAAGACAGACAACTAGCCGAATATCTTTGTATGAATTACGAGA
ACTTGGACAGTGAAGACCTGGGCGCATTTCTTGAAACAGTAGAACAGGGAATCAGTTGGA
TTCTAGATCTTATCGAAAGCAAAGACTTGCTTTATAAACCAAAGTCAGGTAGTAATCATG
CAAAAAGAAAATAAAAAAATCACTTGCTCAAATTTTGGCCAAGGCGAGCAAGCGACACAA
TTCAGAGTATAGAAATTTTTTCTATGCTTTGATTATATCAAAAAACATCTATTCTATCAA
ATATCTAAAGAAAAACCGAAGAGCAGGCAAGCAATTAGAAAAGGTTTTGAAAATCAAGTG
CTGACAGGGTGATTCTAAGACCTTGTTTAGCTGAAAGATGGGTAATTACTCACGAAACAC
TGCTACAAGCGTTCGTCAACTTGGGGCAATCGCCCAGCGTTTGGAGTGGTGAAGCATACC
ATATAGAAAACAGGCAAGAAAAAGGACAAGGAAAGGCTAATGGAGAAAAATATGACTCTA
GATCTAGATAACATGACACAATCAGAATTTGACAACCGAATTACTGAAATCAAGGATAGA
AATCCGAACCTCTTTCAGTTCATCATTGACTTTTTAGATGATAAAGTAACTCCAGAAGAG
GTGTACGACTTTCTAAAGATGGAGCGAAACTATCAAGTAAATTATATCAAGAATTACAAA
GCGAGGGCATAGCATGAATGAATTAGATTTGACCAATATACAATCGGTAATCTTTACGGT
GGTACTGATTGGCTTACTGCTTTATCTAAATCACCGAGACCGCAAAAAAAGCGCTCAAAT
CGAGCGAGAAAGTACACAGACGATTGAAAACAACTAGCGAGGATTTAAGCCCTGATTATG
GGCGATATATTCAGCTTGGAATGGTCAGTAAAGGGGGCTAAGTATGTTTAGTTTGAGTAA
AGAAAGCGAACATGATTTAACTAATAGAATAAGCACGGTTATAGAAAACTATCTAGCAGT
TCGAGAACAACCTAAACCAAGACTAACTGGTTTAATATCAGCACAAGAAGCTATGGACGA
GTTAGATATAAAATACAAAACTTTGCAAAAGTGGGAAGGTGCAGGACTAAGACGTTACCA
ACCACCACTAGAAGATACTAGAAAAGTCTATTACAAAGTTACGGATATTTTGAAGTTCCT
GGGGGTAGATGATGGCAAAGACTAAAATATATTTTTGGTTAAAAGTTGATAAGAAGTTTT
TTGATAACCTTTTTATTAAGCGACTTAAAAATATACCTGGTGGCTACACTATGACAGTGA
TTTATATCCGCCTTATGTTGGAAAGTTTAGAAGATGATTGTATTTTGTACTATGAAGGAT
ATTTTGATAGTTTGGTACAGGAATTAGCTTTAAAACTGGATGTTTCTGAAGATGATATAA
ATATGACAGTTGCGTATTTTACAAAATGCGGACTAATTCAGATAGACGATGATGGCCATG
CCACATTATCGCAAGCAAAAGCCATGGTTGAGAGTGAAACAAACTGGGCGAAATATAAGC
GAGACCAAAGAAAAAATAGTCAAGATATACCAAAATTGGAGAATGTCCAAAATAAAAAGA
CTATTTCCAACTCATGTCCAACAGAGATAGATAAAGAGTCAGATAAAGATAAAGAGTTAT
ATAAAGAATATATATTGTCAGGTAAACCTGACTTTACTTTCCCAAATTGGTTAACTCCGA
GAATGATCGAGGAAATAACTAAAGGACATCCTGAGAAGTATTTAATAAGAATCCCTCTAG
CTTATCTGAATCATACAGTAGGGAAAAATTATAAATATTTGGACAAAAATTTGAAGCCGA
TAATAGCACGATTCAAAGAAGGCTATACACTTGAAGATTTTAAACAGGTGATAGATATTA
AAACGGCAGAATGGAAGGATAGCCCTGAATTTTCTAAATATCTGAGACCAGAAACACTTT
TCGGAACTAAGTTTGACGGTTATTTGAATCAAAAGCCTAAAACCATAAAAGGGAAGTTTG
AAGATAACTTCCCAGACCTACCATTTTAGGAGTTGCAAAGATGAAGGAACAATTTAAAGA
ATTTAATAACAGAAAGATATCGGATAAAGTTTGCGATATTCACCAGGTAAATTATTGGGA
AATTTCTGTACCAGTGTTAGGGAGTTCAGAAAGAAAACTACAAGCATTTTGCCCGGAGTG
TGTGAAGGGAGAGATTAAACAAAAAGAGAAAGACCTATTGCAGCAGTTCGAGGACAGGCA
AGCTTACTTTAAAACTTATGATGTCTTAATGCGTGATAGCACGATTCCTAACGAGTTGAA
GGGGGCAACGTTTGATAATTTCTTTATTAAGACGACAGAGGAACGTCAGATGTTAGAGTT
TGTAAAGGGGCAAGTCCAGAAGTACCTTGCAGGTATGACTGGAAATACTTTAATCAGTGG
TAGCACAGGAATAGGAAAAAGTCATTTATCGCTTGCCTTGGCTAAAGAAATCAATGAGAG
TTTCAGGGAGAAGCACGAGCCTAAGAGTGTCTTGTTTGTCAGCTTAACCGAGATTATCAA
ACAGATAAAAGAAGGCTGGGCTTATGGAAGAAATGCAAACTTAACAGAGTATGAGGCGGT
TAAAAAGTTAGTTGATGTAGATTTTCTAATCATCGATGACCTGGGGGCAAAAAATGGGAC
AATCTCTCCTAAGAGCGATTGGGAACAGGATTTCTTGTTTGATATTATCAATAATCGAGA
AACTACGATTTTCAACACGAATCTAGATAGCAGTGAACTGCGAACGGTTTACAATGCTAG
AAACTCAAGTAGGATTTTGAAAGGTTTAGAAGGGAACACTTTCAAGGCTTTTACGATTAA
AGATAAGAGATACACTATAAACACAGTGAGGGGAGAATATCAATGAATGATGATAAAATG
CGATTTGCAACAGAAAAAGGCTTTGTTGTCTACGAAAAATGTGGTATAATAGAGATAGAA
AAAGTTCCAAGTTTTGGAGAAATTACTTTATTCTATTCAGATGGGAAATTTACCCATCTA
GTCAAAAAAGAAACTAAAAAATAAGTCTATTGAGAACAACTCAGGGACATACCGTAAAGC
ATCTAATGCTAGAGGTATGTCCCTTTTTGTTTGCATAGAAAGGGGGTGAGGGTGATGTCA
GGAGATACTTCTTTAGGGTATGTAGTAGCCAATAAGTTTTCTATGGATCCAGATAAAAGA
CAGAAAATCTTTTCTCAGTGTAAAAAAGAAGATGATAGCTTAGAACAACGGAAACAAGAA
ATACTAGAAAAATATGCTAACAAACAAGACAAATCAAAATCTAGAAAAAATGATTCTAAA
GGCTCGGAGAGTCATAAAAGAAAAGCTAAGAGCTAAGAATTTTAGAAAAAATTATAAACA
AAAATCAGATATTAAAAGATGAAGGAGCAAAAAATGACAACTAACTTAGCTAAACAAAAA
GAAAATCTAGAAGCTTATATCCGAAGTACAGGTTATAACACTAGAGGGATGAACGTAGAA
AATAATCATGTACTCATTGAAAAACCAATCCTTGATAGTTACGAAGATGAACATCAACGT
AAAGAACTGGTTGATCTAGTAAATGTTATTGAGACTCGCACCCGTGGTGGAAAGTATGAA
GTAACTGACTTTGAATCTGATTCATTACAAGAAGTTAGCGAAAATTCGGTTGAGAGAACA
GAAGCAGATAAAAAGAAAACTATCAGCGTTGATTACTTAGTTAAATTATTCAGTGGAAAA
CTTGATTTTTCACAGGAACAATTAGATGATGGTCAATATAATTTAACGGATTTTCTTGGT
AAGAAGATTATTAAATTAAAACGTAGAACACGAAATAGAGAGATTGGGAAAATTCTCCAA
ACTGCGAAAGTGCAGACTGCTACAAGTATGGACGACTTGAAATCTATTGTTTCTTTAATA
AATCCAGAGCGCAATGTATCTATGGTTGTTAGTCAATCACTATTTAGTGTCTTAGAAAAA
ATGAAAGACACTTCAGGAAATTATCTTCTTAAAGTTGATAAAGAGACAGGAACAAGTGAA
ACATTCTTTGTAGATAACTTTTTAATTGTAGATGATACAACATTAGGGAATAAAGGTGAC
AAAAAAGGCTTTATCGGAGATCTAGAAAACTTTGTTACTTTGTTTGATCGCAAGAAAGAT
ACACTTAGTTGGGCGAATGCGAATGACTATTTTGGGAAACGGTTGATTTTACATACCCGA
TTTGATGTAAAAAAAGTTGAAGAAGATTGTGGTTGTCTTATTCAATGGAACTAGGAGAAA
GAAATGGATATTAATCAAGTATTTGAAACACTGGATGATCTAGATAATAAAAAAAGTAAG
ATTAATTCAGCACGAAAACAGTTAAGCGAAAAAAGAAAAAGCCTTTTAGGCAATCAAACA
GTTTCATTTGAGAATATAGATAATTTTTTATCTAACAACTTAGAGTCTTTGGAACAGCTT
GAAAAGATGGAAAAAGCTATTAATTCTCTTCAGGAAAAATATAATAGTGATTTTTCAGAA
GCTAAAGCAGTCATCTTTGAATACATTTTTAAAGAAACTAAGCAACGGATGGAAACTAAG
AAGATCTATAAACAATACCGAAAGAAACTTAGACGAATTCTGGACGCATATGATGAAATT
CAAGAACTAAAGAAGGATGTAGAAGAAATCCATACAGGTGTAGTCAGGGAAATAAGTCAG
AAACATTCTCTATCGCTATATCGAACGGAAGTAAGTCCGCTTACTGTCCTACCATTCTTA
AACCCTGATATTAGCGGGTGGATGGATTTTTTTAAGGAATATCGGGACATTAAAGAGTAT
TTAGAAAAATAGGGAACAAATTAAGTAAGGCTAGTGATATATGGCTGAAACAGAAGAGAT
ATCGCTAGTCCTACTTTTATGCTTTACTAAGTTTCACATAACAAAGTAAGCATAAACTGA
AAAGAAGTAATAGCTTGAAAGCAAGGTATATCAGGGGTTTACAGAATGGAGTGAGTTTCA
CAGAATGTAAGATATGAGAAACTGAGGGGATAAATTAAAGAAATTTCCCTTGAACTTGTC
ATATTGAAGAGTTGTCAAACTTAAAACAATGATACCTGGTAAGTGGAGTGTTGGAAGGCT
TTTAGCGCTTTTTGTCAGTTTGACAGAATTTACAATTTGACAAATTGAAAGATAAAAAAA
TTTTTAAATTTAAGTGGAGGTACTTGCCTATGTACGAGTTGAGTAACAGAGACCTGGACG
GGATAGATATTGAGTTAGGACGATATAGAACACTTGCTAATAAAATTTATTTGAGAAGAC
AGGAACTGATACATAATAAGAAACATAGCACTGAAGATTATACTGGTGGGAAAGGCAAGA
CAGTATCTAGTCCTACTGAAGCGACAATCATTAGAATTGAAGAAGACCAAACGCTAAAAT
ATTTAGAAGGTTTCAAACTAGTTGTAGATACCTTGATGGAAAACTTAATTGAAAGTGATC
TAGTAATTTTTAAAATGAGATATTTAGAAGCTGGTGCGACTTGGGAAGACGTGGCAGAGA
AACTAAATAAAACTACTCGTTATATAAATAGCCGTAGAAAGGTAATCGCTAAAAGATTTG
TGGAATTGAAAGGATATTGACTCCCCCCACCTTTTAAAAAATCTTTCTGCCCAGTAGGGT
ACCGGTGAAGGGAACTTTTTCCAAGTCGGAGCACTTCAGACAAAAAGGGGGTAAAAACTG
GCCGATTTACCAGAAAAATGATTAGTTTTGAAGGGTAAGATACATACGGTAGAGGAGAAA
TAGATAAAACTTGATTTATTGCAGGAAGATAGTAAAAGAGCTATAATAAAGTGGAGCACA
AAGGATTATACTTTTAAAAAAAGGAGACTGTATTCATGGCAAAAAATGATTATTGGGTAA
TTGTTTATAAAATTCTTAGTTATTATTTTCAGAAAATGAAGCATGGAGAGCCAGCCGATG
AAAATGAAATAAACGCTTCAGCTCTAGAAATCCCCTATCTTTACTTAATGGATGTCTATC
GTAATTTATTTGATGATGGATTTTTGACAGGTACTTGTGTAACTGGAGACATGTCTGGAA
ATGTGTATATTGAGAATTTGTCTCTTGTTAGAATTACAACTAAAGGTATTGAATATTTGG
AGGACAACTCTAAAATGAAACAGGCTTATAAAATTTTGAAAGAAATAAAAGATTGGATAC
CTGGAATGTAGCACTTAGATTATTCTAAGTGCTTTTTATTATCAACTGAAAATTAACAAA
AAATTATAATGTTAAATGATAGTTTTGTTGAAGAAAAAATTTAAAAAAGATATAATGAAA
AAGAGAAATAATTATATCTTTTTTAAAAATTAGAAATATAAAAGGAGAATTAAGATGGAA
CTTGCAAGAGTTATTCGCATAATTGATGATTTTACAATTATGATTGACAAAGGTTATGAA
ACTGCTGATATAAAAGAAGGTACCGAGATAATTGTTTTTGAACCTGGTCCAGAAATAAAA
GATTTGGAAGGCAATAGTTTGGGGAGATATGATTTCACTAAAGCTAAGTTAATAACCACT
GAAGTTTTTCAAAAATTTTCAATTGCCCAAAATATTGAGGAGACATCTCCATTCTCTGTT
AATGACTTTTTATCAGGTGGGAAAACTAAGCTATTAATTAATGTCGATGAAGAAGAAATT
GAACCCTTAGCCCCTAAAGATATCCAAGTAAAAAAAGGTGATCTAGTAAGAATTGAAGAT
TTTTAACTTGACACAGAGATAAAATAATGTTACGATAAGAGTGAATTGAATGGCTACGGA
TGTGGCTAGGAAACTACCTCTTATCATTATGATAGGAGGTTTTCTTTTGTGACTGATAAA
CCCAGCATAACATATTCCCAGCAGTTAGATAGAATGAGAAGAAAGGGAATACTTATTGAA
AATGATAAGCTAGCAATGGAAGTTCTTCAAAGTATATCATACTATGGAATAGTAAATGGT
TATAAAGATATTTTTGGAGTATATTTCGATGAAGATTTTCAAATAGAAAGATTTAAAGAA
GAAGTACAATTCTCGTCTATTCATAGTATTTTCCTTCTGGATCAAGCATTGAATAACTTA
TTGTTTAAGTATATTATATACATTGAAAAATCATTAAAAACGAAATTATCTTATAAGATT
GCTCATAAGTATACTACAGAATTTGATTCATATTTAGATTATACAAAATATAGATCTAAT
GGAAGCTTAGATAGAAAATCTGAAATTCAAAACATAAGAAATCAAATTGAAAACAACAAA
AACAGCGCTTCAATTCAGCATTATCGGGAGAGACATGATACAATCCCTCCTTGGGTTGCA
ACCAGCGGCATATATTTTGGGACTGCAATTAATTGGTATAAAATCTGTCAGGATGATATA
AAAGAATACATAGCAAATCAATTTTTTGTAAGTTTTTCAATTGATGATGAAAGCGCAAAA
GAGATGCTTGTTTCTATGTTATCTCTTTTACAAGAATACCGAAACAATATTGCACATGGG
AATAGAACATTTTTATCTAATGTCACTAGTGAATTAACTAAGGATATATTGCTATCATTG
TTCCCAGAGGGAGTATTAACTGAAAGAGAATACCACAAAGGTATTGGGCAAAAAGATTTA
TTTGCGGTAATATTATCAATTGCGGTTTTGATAAATGATCCATTAGTATTTCGCCAATAT
ATTTATGATTTCGGTACAATGTTTAGAAATAAAGATTTTAACCCTAATTTAAAATATTCC
CCTAGAGGGAATTTATACGAAACATTAAATATTCCAGAAGATTTCTTAGATAGAATAGCA
ATAGTATATAATCTAAAATTTAAAAATTAAAGCGACTATTTTATTAGTTGCTTTTTTATT
TTTACGAATAATAAGGTTAGAGGAAGAAAATGAACAATTTAAATATTGATCTTAGTGTAA
ACGTGACTTATAGTGTACCAATACTCAAGAATGAATACACAGTTAAGTTATTGCTCCTAT
TAGATTTTAAAGTAGAGGATAAAGACTTGCTAGATTATTTGGTACCAACCTGGAAGTATC
GTGATCTAGTACTTCATGTGGCACAAATGCATAAAATGGAAAAACAGTGGAAGATATGAT
ATAATTGTTTCCTATTATGTAGACATGAAAAAGGCACAAAAAAGTAAGTATTAAATTGCT
GAAAAATAGTAGTGGTGAGGTAATATGATAAAAAACAGATATTATCACACAACAACGGAT
AATCCTCAAATACTTCGTTTATTTGGTGGTGTTATGCAAGTTTTTGATATCGAAAAAAAG
TGGATTGATAGTATTGATTGGTTTAATAAAATCTATTTCAATGACTTCACGGATTTTGAA
GAAATTTCAGAAAGCGAGGCATTCGCTTATATTGAAAAGCTGAAACACAAAAATTGATAT
AGCACGTTTCGTTGTTAAAATCTTACGTAGAGTAACATAAAAAGCACGTTTTAAAACGTG
CTAGCTTCTTGCCTGCTGAACTCATTAAAAAAGTAGAGTTTTATGTTCAGTGATTTGTGG
AGTAAGGAAGAAACTCCAAAACATTCAAACGAAAAGCGAAAACTCCAAAAACCCTGTTAT
CCAACATTAAGAAGTAATAAAGATACTTGCTGGATATTTAAAAAAGCGATACAACAAAAT
GCTTTAATTTTAAGAAATATCTTACAGAAAGCCTACAACAGTGGGCTTTTTGCTTTGTCT
TAAAAAACGGCTCTTTGTCAACTGTAGTGGGTTGATAAAAAGTTACAACCTAGAGAGGAC
CAAATTGGTTCTCTCCTTTTTGATATTCAAAGCGATGAGAATTCTCGTTTTAAAATTTTC
AAAGTCCCGAAAACCAAAGGCATTGCGCTTGATGAGTTTGATGAGATTATTAGTGGCTTC
CAATTTGGCGTTGGAATAGGGTAATGGGAGAGCGTTGACGATTTTCTCTTTATCTTTGAG
AAATGTCTTAAATACAGTCTGAAAAAGAGGATGAACCTGCTTTAGATTGTCCTCAATAAG
TCCGAAAAATTTGTCAGGCTCTTTATTCTGAAAGTGAAAAAGCAAGAGCTGATAGAGCTG
ATAGTGGTGTTTCAAGTCTTCTGAATAGCTCAAAAGCTTGTCTAGGATTTCTTTATTGGT
TAAATGTGACTGAAATGTTGGACGATAAAATCGTTTACTGCTCAGCGTATAGTTATCCTG
TTGAATGAGTTTCCAGTAACGTTTCAGTGCTTTATATTCGTGCGATCTTCTATCAAACTG
ATTCATAATTTGGACACGCACACGACTCATAGCACGGCTTAGATGTTGTACAATATGGAA
ACGATCTAGAACGATTTTAGCGTTTGGGAGTGAAACAGTCTGGGAGACTGTTTCAGCCTG
AGTCTAGAAATTTGAAAGCGAAGTTGTCTAGCCAAGGCATAGTAAGTGCTAAACATATTC
ATCGTAATGAGTTTCACCTGACAGCGAACGGCTCTATCGTATCGCAGAAAGTGATTTCGG
ATGACAGCTTGTGTTCTTCCCTCAAGGACAGTGATGATATCGAGCTTTTTAAAATCTTGC
GCAATGAAACTCATCTTCATCTCCCGATTGAAACAGTCACTCCCCTAACTGTTTCAACAT
CCCAAGACATAATCTCAGGAAGATGAGAAAAATCATGCTTAAAGTGGAAGTCATTAAGCT
TGCGAATGACAGTTGAAATGGAAAGCTGATGGGCAATGTCGGTCATAGAAGTCTTTTCAA
TCGACTTCTGAGCAATCTTTTGATTGATAATACGAGGGATTTGATGATTTTTCTTTACTA
GAGGAGCCTCAGTGGCCATCATTTTCGAGCAGTGATAGCACTTGAAACGACGCTTTTCAT
AAGAATTCTGGTAGGCATACCAGTTGTTTCGAGGTAAGGAATCTTAGACAGTTTTTGGAA
GTCATATTCTTCATTTGATTTCCGCAATCAGGACAAGATGGGGCCTCGTAGTCCAGTTTA
GCGATGATTTCTTTGTGGGTATCCCTATTAACGACATCCATAATTTGGATATTAGGGTCT
TTGATATCGAGCAGTTTTGAGATAAAATGTAATGGTTCCAT

Region Details

Completeness (score)

incomplete(50)

Most Common Phage Name (# hit genes count)

PHAGE_Lactoc_bIL311_NC_002670(2)
PHAGE_Lactoc_Q33_NC_049809(2)
PHAGE_Lactoc_bIL310_NC_002669(2)
PHAGE_Strept_phi3396_NC_009018(2)
PHAGE_Strept_315.6_NC_004589(2)
PHAGE_Lactob_iA2_NC_028830(2)
PHAGE_Strept_Abc2_NC_013645(1)
PHAGE_Strept_SpSL1_NC_027396(1)
PHAGE_Strept_5093_NC_012753(1)
PHAGE_Strept_315.4_NC_004587(1)
PHAGE_Lactoc_Tuc2009_NC_002703(1)
PHAGE_Strept_K13_NC_024357(1)
PHAGE_Strept_9874_NC_031023(1)
PHAGE_Gordon_GAL1_NC_031936(1)
PHAGE_Strept_20617_NC_023503(1)
PHAGE_Strept_PH10_NC_012756(1)
PHAGE_Temper_phiNIH1.1_NC_003157(1)
PHAGE_Strept_phiARI0131_1_NC_031901(1)
PHAGE_Strept_TP_778L_NC_022776(1)
PHAGE_Strept_phiARI0460_1_NC_031913(1)
PHAGE_Strept_phiARI0468_1_NC_031929(1)
PHAGE_Lactoc_bIL309_NC_002668(1)
PHAGE_Staphy_IME_SA4_NC_029025(1)
PHAGE_Strept_phiARI0462_NC_031942(1)
PHAGE_Strept_315.1_NC_004584(1)
PHAGE_Bacill_BM5_NC_029069(1)
PHAGE_Erysip_SE_1_NC_029078(1)
PHAGE_Strept_EJ_1_NC_005294(1)
PHAGE_Lactoc_lato_NC_004746(1)
PHAGE_Gordon_Apricot_NC_048018(1)
PHAGE_Staphy_phiRS7_NC_022914(1)
PHAGE_Lactoc_63301_NC_031017(1)
PHAGE_Faecal_FP_Brigit_NC_047909(1)
PHAGE_Lactob_Lj928_NC_005354(1)
PHAGE_Entero_vB_IME197_NC_028671(1)
PHAGE_Strept_phiARI0746_NC_031907(1)
PHAGE_Strept_P9_NC_009819(1)
PHAGE_Strept_phiARI0131_2_NC_031941(1)

Region:	The number assigned to the region.
Region Length:	The length of the sequence of that region (in bp).
Completeness:	A prediction of whether the region contains a intact or incomplete prophage based on the above criteria.
Specific Keyword:	The specific phage-related keyword(s) found in protein name(s) in the region.
Region Position:	The start and end positions of the region on the bacterial chromosome.
# tRNA + rRNA + tmRNA:	The number of tRNA, rRNA and tmRNA genes present in the region.
# Total Proteins:	The number of ORFs present in the region.
# Phage Hit Proteins:	The number of proteins in the region with matches in the phage protein database.
# Hypothetical Proteins:	The number of hypothetical proteins in the region without a match in the database.
Phage + Hypothetical Protein %:	The combined percentage of phage proteins and hypothetical proteins in the region.
# Bacterial Proteins:	The number of proteins in the region with matches in the nrfilt database.
Attachment Site:	The putative phage attachment site.
# Phage Species:	The number of different phages that have similar proteins to those in the region.
Most Common Phage:	The phage(s) with the highest number of proteins most similar to those in the region.
First Most Common Phage #:	The highest number of proteins in a phage most similar to those in the region.
First Most Common Phage %:	The percentage of proteins in # Phage Hit Proteins that are most similar to the Most Common Phage proteins.
GC %:	The percentage of GC nucleotides of the region.

Intact (score > 90)

Questionable (score 70-90)

Incomplete (score < 70)

Region:	The number assigned to the region.
Region Length:	The length of the sequence of that region (in bp).
Completeness:	A prediction of whether the region contains a intact or incomplete prophage based on the above criteria.
Score:	The score of the region based on the above criteria.
# Total Proteins:	The number of ORFs present in the region.
Region Position:	The start and end positions of the region on the bacterial chromosome.
Most Common Phage:	The phage(s) with the highest number of proteins most similar to those in the region.
GC %:	The percentage of GC nucleotides of the region.

Criteria for scoring prophage regions (as intact, questionable, or incomplete):
Method 1:

If the number of certain phage organism in this table is more than or equal to 100% of the total number of CDS of the region, the region is marked with total score 150. If less than 100%, method 2 and 3 will be used.

Method 2:

If the number of certain phage organism in this table is more than 50% of the total number of CDS of the region, that phage organism is considered as the major potential phage for that region; the percentage of the total number of that phage organism in this table in the total number of proteins of the region is calculated and then multipled by 100; the percentage of the length of that phage organism in this table in the length of the region is calculated and then multipled by 50 (phage head's encapsulation capability is considered).

Method 3:

If any of the specific phage-related keywords (such as 'capsid', 'head', 'integrase', 'plate', 'tail', 'fiber', 'coat', 'transposase', 'portal', 'terminase', 'protease' or 'lysin') are present, the score will be increased by 10 for each keyword found.
If the size of the region is greater than 30 Kb, the score will be increased by 10.
If there are at least 40 proteins in the region, the score will be increased by 10.
If all of the phage-related proteins and hypothetical proteins constitute more than 70% of the total number of proteins in the region, the score will be increased by 10.

Compared the total score of method 2 with the total score of method 3, the bigger one is chosen as the total score of the region.
If the region's total score is less than 70, it is marked as incomplete; if between 70 to 90, it is marked as questionable; if greater than 90, it is marked as intact.

gi|00000000|ref|JAHZTX010000001.1| Streptococcus oralis strain E665 NODE_722_length_226_cov_0.655629, 2101270, gc%: 41.11%

Download details as .txt file:detail.txt

Integrase

Phage-like protein

Antirepressor

Hypothetical protein

Replication protein

Head protein

Transposase

incomplete

Region 1, total 14 CDS

#	CDS Position	BLAST Hit	E-Value	Sequence
1	1536187..1537353	PP_01479;integrase;phage;PHAGE_Lactoc_bIL310_NC_002669	1.41e-82	Show
2	1537823..1538344	PP_01481;DNA binding protein;phage;PHAGE_Strept_5093_NC_012753	4.85e-22	Show
3	1538573..1538761	PP_01482;putative cro protein;phage;PHAGE_Lactoc_Q33_NC_049809	1.22e-07	Show
4	1538925..1539527	PP_01483;putative antirepressor;phage;PHAGE_Lactoc_Q33_NC_049809	1.66e-32	Show
5	1540549..1540830	PP_01487;hypothetical protein;phage;PHAGE_Lactoc_bIL310_NC_002669	1.46e-07	Show
6	1540817..1541674	PP_01488;putative replication protein;phage;PHAGE_Strept_phi3396_NC_009018	3.5e-72	Show
7	1541686..1542531	PP_01489;ATP-binding phage protein;phage;PHAGE_Strept_phiARI0468_1_NC_031929	4.37e-40	Show
8	1543059..1543919	PP_01492;capsid protein;phage;PHAGE_Staphy_IME_SA4_NC_029025	2.9e-39	Show
9	1544855..1545265	PP_01494;hypothetical protein;phage;PHAGE_Strept_PH10_NC_012756	8.91e-22	Show
10	1545521..1545856	PP_01495;putative major head protein;phage;PHAGE_Lactob_Lj928_NC_005354	5.85e-20	Show
11	1546020..1546391	PP_01496;hypothetical protein;phage;PHAGE_Lactob_iA2_NC_028830	2.66e-06	Show
12	1546494..1547495	PP_01497;Abi family protein;phage;PHAGE_Lactob_iA2_NC_028830	4.37e-37	Show
13	1547850..1548062	PP_01498;hypothetical protein;phage;PHAGE_Strept_phiARI0462_NC_031942	1.72e-31	Show
14	1548408..1549726	PP_01499;transposase;phage;-;PROPHAGE_Staphy_N315	6.27e-06	Show

gi|00000000|ref|JAHZTX010000001.1| Streptococcus oralis strain E665 NODE_722_length_226_cov_0.655629, 2101270, gc%: 41.11%

Download details as .txt file:detail.txt

tRNA

Non phage-like protein

Hypothetical protein

phage abortive infection AbiH family protein

tmRNA

phage replisome organizer N-terminal domain-containing protein

phage scaffolding protein

phage minor capsid protein

phage tail family protein

phage terminase large subunit

phage portal protein

phage capsid protein

phage Gp15 family protein

phage tail protein

Bacterial, total 2396 CDS

#	CDS Position	BLAST Hit	Sequence
1	619..690	tRNA-Glu	Show
2	2585..4543	PP_00003; ATP-dependent zinc metalloprotease FtsH	Show
3	4559..5101	PP_00004; hypoxanthine phosphoribosyltransferase	Show
4	5106..6383	PP_00005; tRNA lysidine(34) synthetase TilS	Show
5	6380..7648	PP_00006; class A beta-lactamase-related serine hydrolase	Show
6	7768..8136	PP_00007; septum formation initiator family protein	Show
7	8129..8395	PP_00008; RNA-binding S4 domain-containing protein	Show
8	8453..11956	PP_00009; transcription-repair coupling factor	Show
9	11957..12526	PP_00010; aminoacyl-tRNA hydrolase	Show
10	12599..13714	PP_00011; redox-regulated ATPase YchF	Show
11	13799..13993	PP_00012; DUF951 family protein	Show
12	14058..15194	PP_00013; DNA polymerase III subunit beta	Show
13	15353..16714	PP_00014; chromosomal replication initiator protein DnaA	Show
14	16931..17689	PP_00015; ParB/RepB/Spo0J family partition protein	Show
15	17747..18937	PP_00016; S1C family serine protease	Show
16	19115..19594	PP_00017; 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	Show
17	19638..19711	tRNA-Arg	Show
18	19877..19999	PP_00018; competence-stimulating peptide ComC	Show
19	20012..21331	PP_00019; competence system sensor histidine kinase ComD	Show
20	21328..22080	PP_00020; competence system response regulator transcription factor ComE	Show
21	22132..22203	tRNA-Glu	Show
22	22209..22282	tRNA-Asn	Show
23	22322..22864	PP_00021; TetR/AcrR family transcriptional regulator	Show
24	22992..25646	PP_00022; YhgE/Pip domain-containing protein	Show
25	25668..28220	PP_00023; YfhO family protein	Show
26	28282..29904	PP_00024; ATP-binding cassette domain-containing protein	Show
27	30100..31125	PP_00025; tryptophan--tRNA ligase	Show
28	31288..32766	PP_00026; IMP dehydrogenase	Show
29	32822..33913	PP_00027; DNA replication/repair protein RecF	Show
30	33916..34284	PP_00028; S4 domain-containing protein YaaA	Show
31	34445..35695	PP_00029; insulinase family protein	Show
32	35692..36975	PP_00030; insulinase family protein	Show
33	37011..37832	PP_00031; helix-turn-helix domain-containing protein	Show
34	37843..38388	PP_00032; CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	Show
35	38385..39212	PP_00033; energy-coupling factor transporter ATPase	Show
36	39197..40036	PP_00034; energy-coupling factor transporter ATPase	Show
37	40029..40823	PP_00035; energy-coupling factor transporter transmembrane protein EcfT	Show
38	40884..41699	PP_00036; rod shape-determining protein MreC	Show
39	41702..42196	PP_00037; rod shape-determining protein MreD	Show
40	42290..43531	PP_00038; CHAP domain-containing protein	Show
41	43756..44535	PP_00039; 30S ribosomal protein S2	Show
42	44614..45654	PP_00040; translation elongation factor Ts	Show
43	45920..46846	PP_00041; cysteine synthase A	Show
44	46943..47386	PP_00042; PH domain-containing protein	Show
45	47402..48037	PP_00043; YigZ family protein	Show
46	48094..49392	PP_00044; DEAD/DEAH box helicase	Show
47	49389..50051	PP_00045; ComF family protein	Show
48	50131..50679	PP_00046; ribosome-associated translation inhibitor RaiA	Show
49	50927..52135	PP_00047; acyl-CoA dehydrogenase family protein	Show
50	52216..53064	PP_00048; 3-hydroxybutyryl-CoA dehydrogenase	Show
51	53083..54261	PP_00049; acetyl-CoA C-acetyltransferase	Show
52	54582..55361	PP_00050; enoyl-CoA hydratase/isomerase family protein	Show
53	55377..56099	PP_00051; 3-oxoacid CoA-transferase subunit A	Show
54	56101..56754	PP_00052; 3-oxoacid CoA-transferase subunit B	Show
55	56949..57857	PP_00053; LysR family transcriptional regulator	Show
56	57873..58985	PP_00054; acyl-CoA dehydrogenase	Show
57	58989..59906	PP_00055; MBL fold metallo-hydrolase	Show
58	60013..60951	PP_00056; nitronate monooxygenase	Show
59	61127..63100	PP_00057; DHH family phosphoesterase	Show
60	63097..63549	PP_00058; 50S ribosomal protein L9	Show
61	63593..64945	PP_00059; replicative DNA helicase	Show
62	64947..65213	PP_00060; hypothetical protein	Show
63	65313..66422	PP_00061; SH3 domain-containing protein	Show
64	66507..69140	PP_00062; DNA polymerase I	Show
65	69418..69708	PP_00063; thiamine-binding protein	Show
66	69671..70429	PP_00064; ABC transporter permease	Show
67	70467..71474	PP_00065; ABC transporter substrate-binding protein	Show
68	71474..72202	PP_00066; ABC transporter ATP-binding protein	Show
69	72321..72779	PP_00067; CtsR family transcriptional regulator	Show
70	72781..75213	PP_00068; ATP-dependent Clp protease ATP-binding subunit	Show
71	75361..76419	PP_00069; AAA family ATPase	Show
72	76429..77208	PP_00070; nicotinamide riboside transporter PnuC	Show
73	77210..77983	PP_00071; NUDIX hydrolase	Show
74	78277..78960	PP_00072; hypothetical protein	Show
75	79087..79773	PP_00073; DUF1275 domain-containing protein	Show
76	79830..80810	PP_00074; tRNA dihydrouridine synthase DusB	Show
77	80797..81669	PP_00075; Hsp33 family molecular chaperone HslO	Show
78	81956..82087	PP_00076; teichoic acid D-Ala incorporation-associated protein DltX	Show
79	82108..83658	PP_00077; D-alanine--poly(phosphoribitol) ligase subunit DltA	Show
80	83655..84899	PP_00078; D-alanyl-lipoteichoic acid biosynthesis protein DltB	Show
81	84912..85151	PP_00079; D-alanine--poly(phosphoribitol) ligase subunit DltC	Show
82	85144..86412	PP_00080; D-alanyl-lipoteichoic acid biosynthesis protein DltD	Show
83	86555..88618	PP_00081; 5'-nucleotidase C-terminal domain-containing protein	Show
84	88769..89209	PP_00082; zinc-dependent transcriptional regulator AdcR	Show
85	89209..89913	PP_00083; metal ABC transporter ATP-binding protein	Show
86	89906..90712	PP_00084; metal ABC transporter permease	Show
87	90722..92227	PP_00085; zinc ABC transporter substrate-binding lipoprotein AdcA	Show
88	92758..94437	PP_00086; alpha-L-fucosidase	Show
89	94474..96561	PP_00087; GH92 family glycosyl hydrolase	Show
90	96732..98012	PP_00088; glycoside hydrolase family 125 protein	Show
91	98068..100713	PP_00089; alpha-mannosidase	Show
92	100812..101681	PP_00090; ROK family protein	Show
93	101675..103555	PP_00091; beta-N-acetylhexosaminidase	Show
94	103736..104797	PP_00092; SIR2 family protein	Show
95	104808..106517	PP_00093; ATP-binding protein	Show
96	106821..107750	PP_00094; sugar ABC transporter permease	Show
97	107764..108687	PP_00095; carbohydrate ABC transporter permease	Show
98	108796..110280	PP_00096; ABC transporter substrate-binding protein	Show
99	110441..111130	PP_00097; CPBP family intramembrane metalloprotease	Show
100	111199..111495	PP_00098; bacteriocin immunity protein	Show
101	111627..112613	PP_00099; rhodanese-related sulfurtransferase	Show
102	112734..113594	PP_00100; DUF4299 domain-containing protein	Show
103	113657..114619	PP_00101; hypothetical protein	Show
104	114682..115614	PP_00102; DUF4097 domain-containing protein	Show
105	115607..116200	PP_00103; DUF1700 domain-containing protein	Show
106	116187..116513	PP_00104; PadR family transcriptional regulator	Show
107	116649..117815	PP_00105; MFS transporter	Show
108	118037..118867	PP_00106; glycosyltransferase	Show
109	118946..120796	PP_00107; polysaccharide biosynthesis protein	Show
110	120888..121517	PP_00108; HAD-IA family hydrolase	Show
111	121545..122417	PP_00109; L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha	Show
112	122426..123097	PP_00110; L-serine ammonia-lyase, iron-sulfur-dependent subunit beta	Show
113	123339..123947	PP_00111; LysM peptidoglycan-binding domain-containing protein	Show
114	123999..124862	PP_00112; helix-turn-helix transcriptional regulator	Show
115	125436..126056	PP_00113; hypothetical protein	Show
116	126580..128688	PP_00115; bacteriocin-associated integral membrane family protein	Show
117	128685..129314	PP_00116; ABC transporter ATP-binding protein	Show
118	129544..130350	PP_00117; ABC transporter substrate-binding protein	Show
119	130366..131562	PP_00118; argininosuccinate synthase	Show
120	131590..132981	PP_00119; argininosuccinate lyase	Show
121	133300..134421	PP_00120; tRNA 2-thiouridine(34) synthase MnmA	Show
122	134562..135017	PP_00121; NUDIX hydrolase	Show
123	135026..135457	PP_00122; NUDIX hydrolase	Show
124	135447..137360	PP_00123; tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	Show
125	137525..139204	PP_00124; ribonuclease J	Show
126	139206..139439	PP_00125; DNA-dependent RNA polymerase auxiliary subunit epsilon family protein	Show
127	140241..140456	PP_00126; hypothetical protein	Show
128	140791..141477	PP_00127; tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	Show
129	141474..141911	PP_00128; ribosomal protein S18-alanine N-acetyltransferase	Show
130	141901..142911	PP_00129; tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	Show
131	143015..143878	PP_00130; helix-turn-helix domain-containing protein	Show
132	144350..146866	PP_00131; lanthionine synthetase	Show
133	146863..148089	PP_00132; MFS transporter	Show
134	148248..148943	PP_00133; AzlC family ABC transporter permease	Show
135	148933..149256	PP_00134; AzlD domain-containing protein	Show
136	149359..150201	PP_00135; transporter substrate-binding domain-containing protein	Show
137	150355..151209	PP_00136; MetQ/NlpA family ABC transporter substrate-binding protein	Show
138	151328..152701	PP_00137; M20/M25/M40 family metallo-hydrolase	Show
139	152694..153755	PP_00138; methionine ABC transporter ATP-binding protein	Show
140	153757..154449	PP_00139; ABC transporter permease	Show
141	154608..155762	PP_00140; D-alanyl-lipoteichoic acid biosynthesis protein DltB	Show
142	155810..156982	PP_00141; D-alanyl-lipoteichoic acid biosynthesis protein DltD	Show
143	157157..157726	PP_00142; MptD family putative ECF transporter S component	Show
144	157860..158474	PP_00143; DUF624 domain-containing protein	Show
145	158452..160122	PP_00144; sensor histidine kinase	Show
146	160134..161420	PP_00145; response regulator transcription factor	Show
147	161479..162012	PP_00146; ABC transporter permease	Show
148	162090..162560	PP_00147; class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	Show
149	162643..163905	PP_00148; divalent metal cation transporter	Show
150	164119..164364	PP_00149; MarR family transcriptional regulator	Show
151	164923..166614	PP_00150; arginine--tRNA ligase	Show
152	166769..167215	PP_00151; arginine repressor	Show
153	167266..169800	PP_00152; DNA mismatch repair protein MutS	Show
154	169842..170300	PP_00153; DUF3021 domain-containing protein	Show
155	170297..170737	PP_00154; LytTR family DNA-binding domain-containing protein	Show
156	170946..172895	PP_00155; DNA mismatch repair endonuclease MutL	Show
157	173045..173542	PP_00156; helix-turn-helix domain-containing protein	Show
158	173701..174294	PP_00157; Holliday junction branch migration protein RuvA	Show
159	174304..174867	PP_00158; DNA-3-methyladenine glycosylase I	Show
160	174953..175216	PP_00159; SWEET family sugar transporter	Show
161	175322..176356	PP_00160; LD-carboxypeptidase	Show
162	176499..177176	PP_00161; DUF1129 family protein	Show
163	177188..178132	PP_00162; magnesium transporter CorA family protein	Show
164	178270..181101	PP_00163; excinuclease ABC subunit UvrA	Show
165	181094..182155	PP_00164; Xaa-Pro peptidase family protein	Show
166	182556..185216	PP_00165; magnesium-translocating P-type ATPase	Show
167	185351..185749	PP_00166; transcriptional regulator Spx	Show
168	185815..186384	PP_00167; transcriptional regulator	Show
169	186471..186737	PP_00168; IreB family regulatory phosphoprotein	Show
170	186741..187160	PP_00169; Holliday junction resolvase RuvX	Show
171	187176..187481	PP_00170; DUF1292 domain-containing protein	Show
172	187738..188988	PP_00171; bifunctional folylpolyglutamate synthase/dihydrofolate synthase	Show
173	189079..189534	PP_00172; lipocalin/fatty acid-binding family protein	Show
174	189719..190870	PP_00173; iron-containing alcohol dehydrogenase	Show
175	190975..192243	PP_00174; glycosyl transferase	Show
176	192247..193227	PP_00175; SDR family NAD(P)-dependent oxidoreductase	Show
177	193202..194017	PP_00176; MBL fold metallo-hydrolase	Show
178	193995..195257	PP_00177; CoF synthetase	Show
179	195272..196216	PP_00178; 3-oxoacyl-ACP synthase	Show
180	196352..197884	PP_00179; cardiolipin synthase	Show
181	197958..198101	PP_00180; hypothetical protein	Show
182	198137..199654	PP_00181; damage-inducible protein CinA	Show
183	199773..201980	PP_00182; anaerobic ribonucleoside-triphosphate reductase	Show
184	201992..202132	PP_00183; hypothetical protein	Show
185	202177..202677	PP_00184; GNAT family N-acetyltransferase	Show
186	202682..203278	PP_00185; anaerobic ribonucleoside-triphosphate reductase activating protein	Show
187	204167..204475	PP_00187; 30S ribosomal protein S10	Show
188	204692..205318	PP_00188; 50S ribosomal protein L3	Show
189	205343..205966	PP_00189; 50S ribosomal protein L4	Show
190	205966..206262	PP_00190; 50S ribosomal protein L23	Show
191	206280..207113	PP_00191; 50S ribosomal protein L2	Show
192	207217..207498	PP_00192; 30S ribosomal protein S19	Show
193	207510..207854	PP_00193; 50S ribosomal protein L22	Show
194	207867..208520	PP_00194; 30S ribosomal protein S3	Show
195	208524..208937	PP_00195; 50S ribosomal protein L16	Show
196	208947..209153	PP_00196; 50S ribosomal protein L29	Show
197	209178..209438	PP_00197; 30S ribosomal protein S17	Show
198	209464..209832	PP_00198; 50S ribosomal protein L14	Show
199	210016..210321	PP_00199; 50S ribosomal protein L24	Show
200	210345..210887	PP_00200; 50S ribosomal protein L5	Show
201	210905..211090	PP_00201; type Z 30S ribosomal protein S14	Show
202	211304..211702	PP_00202; 30S ribosomal protein S8	Show
203	211889..212425	PP_00203; 50S ribosomal protein L6	Show
204	212509..212865	PP_00204; 50S ribosomal protein L18	Show
205	212883..213377	PP_00205; 30S ribosomal protein S5	Show
206	213391..213573	PP_00206; 50S ribosomal protein L30	Show
207	213719..214159	PP_00207; 50S ribosomal protein L15	Show
208	214172..215482	PP_00208; preprotein translocase subunit SecY	Show
209	215628..216266	PP_00209; adenylate kinase	Show
210	216383..216601	PP_00210; translation initiation factor IF-1	Show
211	216626..216742	PP_00211; 50S ribosomal protein L36	Show
212	216760..217125	PP_00212; 30S ribosomal protein S13	Show
213	217143..217526	PP_00213; 30S ribosomal protein S11	Show
214	217569..218504	PP_00214; DNA-directed RNA polymerase subunit alpha	Show
215	218516..218902	PP_00215; 50S ribosomal protein L17	Show
216	219166..219432	PP_00216; ACT domain-containing protein	Show
217	219442..220779	PP_00217; PFL family protein	Show
218	221016..221708	PP_00218; phosphoglycerate mutase family protein	Show
219	221811..223469	PP_00219; iron ABC transporter permease	Show
220	223459..224550	PP_00220; ABC transporter ATP-binding protein	Show
221	224563..225609	PP_00221; ABC transporter substrate-binding protein	Show
222	225772..226812	PP_00222; ABC transporter substrate-binding protein	Show
223	227029..227799	PP_00223; response regulator	Show
224	227792..229441	PP_00224; histidine kinase	Show
225	229589..232090	PP_00225; leucine--tRNA ligase	Show
226	232346..232759	PP_00226; YjdF family protein	Show
227	233259..234125	PP_00227; ABC transporter ATP-binding protein	Show
228	234125..234967	PP_00228; ABC transporter permease	Show
229	234986..235441	PP_00229; LytTR family transcriptional regulator DNA-binding domain-containing protein	Show
230	235451..235870	PP_00230; DUF3021 domain-containing protein	Show
231	235964..236659	PP_00231; GNAT family N-acetyltransferase	Show
232	236671..237087	PP_00232; GNAT family N-acetyltransferase	Show
233	237602..238573	PP_00233; Holliday junction branch migration DNA helicase RuvB	Show
234	238554..239144	PP_00234; nucleotidyltransferase family protein	Show
235	239349..240107	PP_00235; isoprenyl transferase	Show
236	240116..240919	PP_00236; phosphatidate cytidylyltransferase	Show
237	240935..242191	PP_00237; RIP metalloprotease RseP	Show
238	242208..244061	PP_00238; proline--tRNA ligase	Show
239	244169..245548	PP_00239; glycoside hydrolase family 1 protein	Show
240	245587..246000	PP_00240; EamA family transporter	Show
241	246216..248024	PP_00241; glutamine--fructose-6-phosphate transaminase (isomerizing)	Show
242	249418..250275	PP_00243; 5'-nucleotidase, lipoprotein e(P4) family	Show
243	251052..251621	PP_00245; isoprenylcysteine carboxylmethyltransferase family protein	Show
244	251725..251868	PP_00246; phosphotransferase	Show
245	251872..252036	PP_00247; hypothetical protein	Show
246	253335..257234	PP_00250; pullulanase	Show
247	257677..261288	PP_00251; DNA-directed RNA polymerase subunit beta	Show
248	261321..264986	PP_00252; DNA-directed RNA polymerase subunit beta'	Show
249	265095..265514	PP_00253; nucleoside-diphosphate kinase	Show
250	265651..266274	PP_00254; hypothetical protein	Show
251	266360..266803	PP_00255; tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	Show
252	266793..267314	PP_00256; GNAT family N-acetyltransferase	Show
253	267319..268359	PP_00257; LCP family protein	Show
254	268433..269689	PP_00258; competence/damage-inducible protein A	Show
255	269744..270892	PP_00259; recombinase RecA	Show
256	271012..271566	PP_00260; GNAT family N-acetyltransferase	Show
257	271676..273046	PP_00261; MATE family efflux transporter	Show
258	273143..273859	PP_00262; YebC/PmpR family DNA-binding transcriptional regulator	Show
259	273907..274596	PP_00263; DUF308 domain-containing protein	Show
260	274790..275251	PP_00264; MarR family winged helix-turn-helix transcriptional regulator	Show
261	275235..277004	PP_00265; ABC transporter ATP-binding protein/permease	Show
262	276994..278754	PP_00266; ABC transporter ATP-binding protein/permease	Show
263	278854..279357	PP_00267; phosphatase PAP2 family protein	Show
264	279471..279917	PP_00268; LytTR family DNA-binding domain-containing protein	Show
265	279924..280598	PP_00269; hypothetical protein	Show
266	280855..281037	PP_00270; hypothetical protein	Show
267	281037..282161	PP_00271; replication initiator protein A	Show
268	282155..282322	PP_00272; hypothetical protein	Show
269	282327..282557	PP_00273; thiopurine S-methyltransferase	Show
270	282718..282933	PP_00274; helix-turn-helix domain-containing protein	Show
271	283224..283526	PP_00275; hypothetical protein	Show
272	283545..284357	PP_00276; LPXTG cell wall anchor domain-containing protein	Show
273	284384..288082	PP_00277; LPXTG cell wall anchor domain-containing protein	Show
274	288146..288652	PP_00278; hypothetical protein	Show
275	288725..288949	PP_00279; hypothetical protein	Show
276	288976..289722	PP_00280; hypothetical protein	Show
277	289738..290163	PP_00281; hypothetical protein	Show
278	290182..290529	PP_00282; PrgI family protein	Show
279	290489..292843	PP_00283; AAA family ATPase	Show
280	292870..295506	PP_00284; CHAP domain-containing protein	Show
281	295526..296170	PP_00285; hypothetical protein	Show
282	296167..296439	PP_00286; type III restriction endonuclease	Show
283	296393..297232	PP_00287; hypothetical protein	Show
284	297245..297763	PP_00288; hypothetical protein	Show
285	297760..299559	PP_00289; type IV secretory system conjugative DNA transfer family protein	Show
286	299580..299843	PP_00290; hypothetical protein	Show
287	299834..305056	PP_00291; ssDNA-binding domain-containing protein	Show
288	305127..305543	PP_00292; hypothetical protein	Show
289	305761..306153	PP_00293; MobC family plasmid mobilization relaxosome protein	Show
290	306147..307781	PP_00294; relaxase/mobilization nuclease domain-containing protein	Show
291	307990..308796	PP_00295; ParA family protein	Show
292	308849..309082	PP_00296; hypothetical protein	Show
293	309210..310502	PP_00297; ISLre2 family transposase	Show
294	310943..311131	PP_00298; 50S ribosomal protein L28	Show
295	311390..311755	PP_00299; Asp23/Gls24 family envelope stress response protein	Show
296	311758..313425	PP_00300; DAK2 domain-containing protein	Show
297	313550..313756	PP_00301; hypothetical protein	Show
298	313753..313947	PP_00302; hypothetical protein	Show
299	313934..314809	PP_00303; ABC transporter ATP-binding protein	Show
300	314822..315556	PP_00304; ABC transporter permease	Show
301	315561..316658	PP_00305; sensor histidine kinase	Show
302	316660..317259	PP_00306; response regulator transcription factor	Show
303	317576..317989	PP_00307; 30S ribosomal protein S12	Show
304	318009..318479	PP_00308; 30S ribosomal protein S7	Show
305	318835..320916	PP_00309; elongation factor G	Show
306	321247..322947	PP_00310; acetolactate synthase large subunit	Show
307	322940..323416	PP_00311; acetolactate synthase small subunit	Show
308	323507..324529	PP_00312; ketol-acid reductoisomerase	Show
309	324609..325859	PP_00313; threonine ammonia-lyase IlvA	Show
310	325942..326838	PP_00314; SPFH domain-containing protein	Show
311	326945..327160	PP_00315; hypothetical protein	Show
312	327253..327993	PP_00316; amino acid ABC transporter ATP-binding protein	Show
313	327990..329558	PP_00317; ABC transporter substrate-binding protein/permease	Show
314	329689..331581	PP_00318; DUF2207 domain-containing protein	Show
315	331643..332488	PP_00319; undecaprenyl-diphosphate phosphatase	Show
316	332522..333583	PP_00320; DNA polymerase IV	Show
317	333821..336136	PP_00321; formate C-acetyltransferase	Show
318	336530..338635	PP_00322; ATP-dependent Clp protease ATP-binding subunit	Show
319	338696..339178	PP_00323; S-ribosylhomocysteine lyase	Show
320	339474..340181	PP_00324; ATP-binding cassette domain-containing protein	Show
321	340183..340971	PP_00325; ABC transporter permease	Show
322	340971..341693	PP_00326; lantibiotic ABC transporter permease	Show
323	341706..342404	PP_00327; response regulator transcription factor	Show
324	342371..343402	PP_00328; HAMP domain-containing histidine kinase	Show
325	343537..345021	PP_00329; DUF1846 domain-containing protein	Show
326	345174..346784	PP_00330; alpha-glucosidase	Show
327	347985..349952	PP_00332; peptide ABC transporter substrate-binding protein	Show
328	350100..352061	PP_00333; peptide ABC transporter substrate-binding protein	Show
329	352253..353698	PP_00334; LCP family protein	Show
330	353700..354431	PP_00335; tyrosine protein phosphatase	Show
331	354440..355132	PP_00336; capsular polysaccharide biosynthesis protein CpsC	Show
332	355142..355831	PP_00337; tyrosine-protein kinase	Show
333	355847..357214	PP_00338; sugar transferase	Show
334	357243..358415	PP_00339; glycosyltransferase family 1 protein	Show
335	358419..359576	PP_00340; glycosyltransferase family 4 protein	Show
336	359579..360577	PP_00341; Stealth CR1 domain-containing protein	Show
337	360612..361586	PP_00342; glycosyltransferase family 2 protein	Show
338	361620..362780	PP_00343; polysaccharide polymerase	Show
339	362777..364189	PP_00344; flippase	Show
340	364199..365302	PP_00345; UDP-galactopyranose mutase	Show
341	365330..366382	PP_00346; galactofuranosyltransferase	Show
342	366454..367323	PP_00347; glucose-1-phosphate thymidylyltransferase RfbA	Show
343	367324..367917	PP_00348; dTDP-4-dehydrorhamnose 3,5-epimerase family protein	Show
344	367936..368982	PP_00349; dTDP-glucose 4,6-dehydratase	Show
345	369043..369897	PP_00350; dTDP-4-dehydrorhamnose reductase	Show
346	370143..372125	PP_00351; peptide ABC transporter substrate-binding protein	Show
347	372403..378870	PP_00352; YSIRK-type signal peptide-containing protein	Show
348	379011..387371	PP_00353; beta-N-acetylglucosaminidase domain-containing protein	Show
349	387539..389704	PP_00354; penicillin-binding protein PBP1A	Show
350	389701..390297	PP_00355; Holliday junction resolvase RecU	Show
351	390364..390891	PP_00356; DUF1273 domain-containing protein	Show
352	390949..391287	PP_00357; cell division regulator GpsB	Show
353	391776..392933	PP_00358; class I SAM-dependent RNA methyltransferase	Show
354	392946..394388	PP_00359; Holliday junction resolvase	Show
355	394464..395888	PP_00360; NADP-dependent phosphogluconate dehydrogenase	Show
356	395900..396589	PP_00361; response regulator transcription factor	Show
357	396689..397681	PP_00362; choline-binding protein CbpF	Show
358	397802..398680	PP_00363; mevalonate kinase	Show
359	398662..399615	PP_00364; diphosphomevalonate decarboxylase	Show
360	399602..400609	PP_00365; phosphomevalonate kinase	Show
361	400593..401594	PP_00366; type 2 isopentenyl-diphosphate Delta-isomerase	Show
362	401761..402459	PP_00367; cell wall-active antibiotics response protein	Show
363	402456..403454	PP_00368; sensor histidine kinase	Show
364	403465..404097	PP_00369; response regulator transcription factor	Show
365	404098..404754	PP_00370; DNA alkylation repair protein	Show
366	404845..406128	PP_00371; trigger factor	Show
367	406176..408545	PP_00372; ATP-dependent RecD-like DNA helicase	Show
368	408675..409289	PP_00373; signal peptidase I	Show
369	409293..410174	PP_00374; ribonuclease HIII	Show
370	410261..410563	PP_00375; hypothetical protein	Show
371	410560..411108	PP_00376; CvpA family protein	Show
372	411222..413558	PP_00377; endonuclease MutS2	Show
373	413902..415224	PP_00378; sodium:alanine symporter family protein	Show
374	415356..415904	PP_00379; carboxymuconolactone decarboxylase family protein	Show
375	416016..416915	PP_00380; TDT family transporter	Show
376	416939..418213	PP_00381; serine--tRNA ligase	Show
377	418426..418797	PP_00382; DUF956 family protein	Show
378	418800..420164	PP_00383; aspartate kinase	Show
379	420447..421232	PP_00384; enoyl-CoA hydratase	Show
380	421323..421757	PP_00385; MarR family transcriptional regulator	Show
381	421757..422731	PP_00386; ketoacyl-ACP synthase III	Show
382	422789..423013	PP_00387; acyl carrier protein	Show
383	423131..424105	PP_00388; enoyl-[acyl-carrier-protein] reductase FabK	Show
384	424098..425018	PP_00389; ACP S-malonyltransferase	Show
385	425063..425794	PP_00390; 3-oxoacyl-[acyl-carrier-protein] reductase	Show
386	425823..427058	PP_00391; beta-ketoacyl-ACP synthase II	Show
387	427061..427549	PP_00392; acetyl-CoA carboxylase biotin carboxyl carrier protein	Show
388	427546..427968	PP_00393; 3-hydroxyacyl-ACP dehydratase FabZ	Show
389	427980..429347	PP_00394; acetyl-CoA carboxylase biotin carboxylase subunit	Show
390	429383..430249	PP_00395; acetyl-CoA carboxylase, carboxyltransferase subunit beta	Show
391	430246..431013	PP_00396; acetyl-CoA carboxylase carboxyl transferase subunit alpha	Show
392	431161..431862	PP_00397; CPBP family intramembrane metalloprotease	Show
393	432083..432265	PP_00398; hypothetical protein	Show
394	432292..433017	PP_00399; CPBP family intramembrane metalloprotease	Show
395	433066..433488	PP_00400; transcription antitermination factor NusB	Show
396	433481..433870	PP_00401; Asp23/Gls24 family envelope stress response protein	Show
397	433892..434452	PP_00402; elongation factor P	Show
398	434534..435661	PP_00403; SPFH domain-containing protein	Show
399	435670..436626	PP_00404; zinc-ribbon domain-containing transport protein	Show
400	436726..437121	PP_00405; hypothetical protein	Show
401	437179..438624	PP_00406; Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	Show
402	438624..440090	PP_00407; Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	Show
403	440090..440392	PP_00408; Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	Show
404	440558..441250	PP_00409; TIGR02206 family membrane protein	Show
405	441393..442937	PP_00410; peptide chain release factor 3	Show
406	443665..446933	PP_00411; accessory Sec-dependent serine-rich glycoprotein adhesin	Show
407	446934..447813	PP_00412; MBL fold metallo-hydrolase	Show
408	447999..448739	PP_00413; adaptor protein MecA	Show
409	448894..450180	PP_00414; homoserine dehydrogenase	Show
410	450182..451051	PP_00415; homoserine kinase	Show
411	451150..452088	PP_00416; peptide-methionine (R)-S-oxide reductase MsrB	Show
412	452148..453872	PP_00417; ABC transporter ATP-binding protein/permease	Show
413	453874..455622	PP_00418; ABC transporter ATP-binding protein/permease	Show
414	455723..456982	PP_00419; TRZ/ATZ family protein	Show
415	457219..457719	PP_00420; 50S ribosomal protein L10	Show
416	457792..458160	PP_00421; 50S ribosomal protein L7/L12	Show
417	458571..459473	PP_00422; DUF2268 domain-containing protein	Show
418	459536..459904	PP_00423; EXLDI protein	Show
419	460119..461123	PP_00424; NADP-dependent oxidoreductase	Show
420	461140..461784	PP_00425; TetR/AcrR family transcriptional regulator	Show
421	461881..463227	PP_00426; NADP-specific glutamate dehydrogenase	Show
422	463432..464367	PP_00427; dihydroorotate oxidase	Show
423	464400..465434	PP_00428; DNA polymerase III subunit delta	Show
424	465507..466112	PP_00429; superoxide dismutase SodA	Show
425	466266..466796	PP_00430; YutD family protein	Show
426	466817..467902	PP_00431; 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	Show
427	467904..468383	PP_00432; VanZ family protein	Show
428	468385..469926	PP_00433; ATP-binding cassette domain-containing protein	Show
429	469982..470785	PP_00434; peptidylprolyl isomerase	Show
430	471091..471315	PP_00435; helix-turn-helix transcriptional regulator	Show
431	471318..471896	PP_00436; DUF3796 domain-containing protein	Show
432	472475..472747	PP_00437; 30S ribosomal protein S16	Show
433	472767..473006	PP_00438; RNA-binding protein KphA	Show
434	473050..473379	PP_00439; nucleotide pyrophosphohydrolase	Show
435	473708..474610	PP_00440; DMT family transporter	Show
436	474760..475617	PP_00441; alpha/beta hydrolase	Show
437	475715..476503	PP_00442; alpha/beta hydrolase	Show
438	476534..477052	PP_00443; ribosome maturation factor RimM	Show
439	477042..477761	PP_00444; tRNA (guanosine(37)-N1)-methyltransferase TrmD	Show
440	477773..478111	PP_00445; hypothetical protein	Show
441	478142..478462	PP_00446; hypothetical protein	Show
442	478566..478784	PP_00447; YdbC family protein	Show
443	478818..479375	PP_00448; TetR/AcrR family transcriptional regulator	Show
444	479768..480304	PP_00449; biotin transporter BioY	Show
445	480448..481794	PP_00450; glutathione-disulfide reductase	Show
446	482060..483244	PP_00451; efflux RND transporter periplasmic adaptor subunit	Show
447	483228..483929	PP_00452; ABC transporter ATP-binding protein	Show
448	483931..485190	PP_00453; ABC transporter permease	Show
449	485327..487324	PP_00454; methionine--tRNA ligase	Show
450	487341..487874	PP_00455; DNA topology modulation protein	Show
451	487927..488163	PP_00456; 30S ribosomal protein S20	Show
452	488231..489151	PP_00457; type I pantothenate kinase	Show
453	489386..489976	PP_00458; class I SAM-dependent methyltransferase	Show
454	489973..491250	PP_00459; pyrimidine-nucleoside phosphorylase	Show
455	491270..491932	PP_00460; deoxyribose-phosphate aldolase	Show
456	491919..492308	PP_00461; cytidine deaminase	Show
457	492398..493453	PP_00462; BMP family protein	Show
458	493590..495125	PP_00463; ABC transporter ATP-binding protein	Show
459	495118..496176	PP_00464; ABC transporter permease	Show
460	496179..497135	PP_00465; ABC transporter permease	Show
461	497170..497811	PP_00466; glycerol-3-phosphate 1-O-acyltransferase PlsY	Show
462	497947..499890	PP_00467; DNA topoisomerase IV subunit B	Show
463	499909..500736	PP_00468; hypothetical protein	Show
464	501639..502373	PP_00470; CPBP family intramembrane metalloprotease	Show
465	502426..504906	PP_00471; DNA topoisomerase IV subunit A	Show
466	505038..506060	PP_00472; branched-chain amino acid aminotransferase	Show
467	506173..506403	PP_00473; DUF2969 domain-containing protein	Show
468	506453..506533	tRNA-Tyr	Show
469	506542..506613	tRNA-Gln	Show
470	506776..507978	PP_00474; 30S ribosomal protein S1	Show
471	508061..508558	PP_00475; GAF domain-containing protein	Show
472	508558..510216	PP_00476; DNA polymerase III subunit gamma/tau	Show
473	510244..510438	PP_00477; DUF3272 domain-containing protein	Show
474	510591..511361	PP_00478; Fe-S cluster assembly ATPase SufC	Show
475	511389..512651	PP_00479; Fe-S cluster assembly protein SufD	Show
476	512662..513888	PP_00480; cysteine desulfurase	Show
477	513875..514312	PP_00481; SUF system NifU family Fe-S cluster assembly protein	Show
478	514373..515785	PP_00482; Fe-S cluster assembly protein SufB	Show
479	515911..517308	PP_00483; amino acid permease	Show
480	517330..518178	PP_00484; YitT family protein	Show
481	518322..519158	PP_00485; DegV family protein	Show
482	519265..519540	PP_00486; HU family DNA-binding protein	Show
483	519819..520805	PP_00487; L-lactate dehydrogenase	Show
484	520999..523467	PP_00488; DNA gyrase subunit A	Show
485	523467..524213	PP_00489; class A sortase	Show
486	524425..525222	PP_00490; formate/nitrite transporter family protein	Show
487	525372..526652	PP_00491; O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	Show
488	526747..528021	PP_00492; DUF2130 domain-containing protein	Show
489	528029..528940	PP_00493; hypothetical protein	Show
490	529027..529404	PP_00494; SdpI family protein	Show
491	529515..530393	PP_00495; tRNA pseudouridine(55) synthase TruB	Show
492	530504..531142	PP_00496; uridine kinase	Show
493	531271..532611	PP_00497; exodeoxyribonuclease VII large subunit	Show
494	532589..532801	PP_00498; exodeoxyribonuclease VII small subunit	Show
495	532798..533673	PP_00499; polyprenyl synthetase family protein	Show
496	533666..534481	PP_00500; TlyA family RNA methyltransferase	Show
497	534474..534905	PP_00501; arginine repressor	Show
498	534912..536579	PP_00502; DNA repair protein RecN	Show
499	536580..537308	PP_00503; serine/threonine protein phosphatase	Show
500	537387..539210	PP_00504; translation elongation factor 4	Show
501	539349..539972	PP_00505; hypothetical protein	Show
502	540054..540902	PP_00506; DNA-processing protein DprA	Show
503	541020..543107	PP_00507; type I DNA topoisomerase	Show
504	543214..543573	PP_00508; YbaN family protein	Show
505	543667..544299	PP_00509; copper homeostasis protein CutC	Show
506	544343..544999	PP_00510; MmcQ/YjbR family DNA-binding protein	Show
507	545314..546876	PP_00511; 2-isopropylmalate synthase	Show
508	546888..547925	PP_00512; 3-isopropylmalate dehydrogenase	Show
509	547922..548191	PP_00513; DUF1294 domain-containing protein	Show
510	548195..549577	PP_00514; 3-isopropylmalate dehydratase large subunit	Show
511	549587..550180	PP_00515; 3-isopropylmalate dehydratase small subunit	Show
512	550207..550986	PP_00516; translation factor (SUA5)	Show
513	551202..553190	PP_00517; AAA family ATPase	Show
514	553177..554481	PP_00518; McrC family protein	Show
515	554656..555642	PP_00519; GMP reductase	Show
516	555710..555781	tRNA-Arg	Show
517	555965..556663	PP_00520; ribonuclease III	Show
518	556654..560193	PP_00521; chromosome segregation protein SMC	Show
519	560337..561263	PP_00522; bifunctional riboflavin kinase/FAD synthetase	Show
520	561411..561605	PP_00523; hypothetical protein	Show
521	561681..561917	PP_00524; AbrB family transcriptional regulator	Show
522	561914..562327	PP_00525; type II toxin-antitoxin system death-on-curing family toxin	Show
523	562420..563235	PP_00526; TIGR03943 family protein	Show
524	563232..564137	PP_00527; permease	Show
525	564994..566985	PP_00528; site-specific DNA-methyltransferase	Show
526	566989..569622	PP_00529; DEAD/DEAH box helicase family protein	Show
527	571139..573268	PP_00531; RNA-binding transcriptional accessory protein	Show
528	573255..573704	PP_00532; SprT family protein	Show
529	573764..574036	PP_00533; PspC domain-containing protein	Show
530	574141..574791	PP_00534; ABC transporter ATP-binding protein	Show
531	574793..576787	PP_00535; DUF1430 domain-containing protein	Show
532	577202..577960	PP_00536; ABC transporter ATP-binding protein	Show
533	577962..579950	PP_00537; ABC transporter permease	Show
534	579989..580684	PP_00538; VIT family protein	Show
535	580890..581681	PP_00539; Cof-type HAD-IIB family hydrolase	Show
536	581681..582499	PP_00540; Cof-type HAD-IIB family hydrolase	Show
537	582503..583813	PP_00541; signal recognition particle-docking protein FtsY	Show
538	583853..585340	PP_00542; glucose-6-phosphate dehydrogenase	Show
539	585489..586229	PP_00543; amino acid ABC transporter ATP-binding protein	Show
540	586229..588394	PP_00544; ABC transporter substrate-binding protein/permease	Show
541	588575..590563	PP_00545; excinuclease ABC subunit B	Show
542	590578..591204	PP_00546; NAD(P)H-dependent oxidoreductase	Show
543	591232..591795	PP_00547; GNAT family N-acetyltransferase	Show
544	591761..592249	PP_00548; GNAT family N-acetyltransferase	Show
545	592322..592789	PP_00549; 8-oxo-dGTP diphosphatase	Show
546	592786..593301	PP_00550; transcription repressor NadR	Show
547	593313..593840	PP_00551; ECF transporter S component	Show
548	594016..594579	PP_00552; ECF transporter S component	Show
549	594563..595114	PP_00553; phosphopantothenoylcysteine decarboxylase	Show
550	595126..595815	PP_00554; phosphopantothenate--cysteine ligase	Show
551	596048..597718	PP_00555; formate--tetrahydrofolate ligase	Show
552	597790..598302	PP_00556; GNAT family N-acetyltransferase	Show
553	598391..600682	PP_00557; DNA helicase PcrA	Show
554	600725..601405	PP_00558; DNA repair protein RadC	Show
555	601402..602091	PP_00559; gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	Show
556	602107..602748	PP_00560; redox-sensing transcriptional repressor Rex	Show
557	602842..603045	PP_00561; DUF4649 family protein	Show
558	603052..603399	PP_00562; DUF1831 domain-containing protein	Show
559	603404..604519	PP_00563; cysteine desulfurase	Show
560	604529..605488	PP_00564; ribose-phosphate diphosphokinase	Show
561	605600..606169	PP_00565; CYTH domain-containing protein	Show
562	606298..606969	PP_00566; GTP pyrophosphokinase family protein	Show
563	606953..607771	PP_00567; NAD kinase	Show
564	607768..608664	PP_00568; RluA family pseudouridine synthase	Show
565	608708..609682	PP_00569; phosphate acetyltransferase	Show
566	609765..610943	PP_00570; A/G-specific adenine glycosylase	Show
567	611001..611708	PP_00571; response regulator transcription factor	Show
568	611701..613050	PP_00572; cell wall metabolism sensor histidine kinase VicK	Show
569	613052..613861	PP_00573; MBL fold metallo-hydrolase	Show
570	613895..614242	PP_00574; PedC/BrcD family bacteriocin maturation disulfide isomerase	Show
571	614353..616071	PP_00575; phospho-sugar mutase	Show
572	616299..618200	PP_00576; ABC-F family ATP-binding cassette domain-containing protein	Show
573	618204..619067	PP_00577; XRE/MutR family transcriptional regulator	Show
574	620417..622375	PP_00579; NAD-dependent DNA ligase LigA	Show
575	622532..624817	PP_00580; type I pullulanase	Show
576	625015..626439	PP_00581; NADP-dependent glyceraldehyde-3-phosphate dehydrogenase	Show
577	626712..628607	PP_00582; 1,4-alpha-glucan branching protein GlgB	Show
578	628766..629908	PP_00583; glucose-1-phosphate adenylyltransferase	Show
579	629898..631037	PP_00584; glucose-1-phosphate adenylyltransferase subunit GlgD	Show
580	631034..632467	PP_00585; glycogen synthase GlgA	Show
581	632526..633170	PP_00586; phosphoserine phosphatase SerB	Show
582	633180..634295	PP_00587; glycerate kinase	Show
583	634292..634738	PP_00588; DUF1694 domain-containing protein	Show
584	634901..636205	PP_00589; phosphopyruvate hydratase	Show
585	636382..636876	PP_00590; YkgJ family cysteine cluster protein	Show
586	637077..637913	PP_00591; AraC family transcriptional regulator	Show
587	638098..639012	PP_00592; peptidase	Show
588	639138..639680	PP_00593; ClbS/DfsB family four-helix bundle protein	Show
589	639966..640469	PP_00594; hypothetical protein	Show
590	640797..641684	PP_00595; hypothetical protein	Show
591	641745..642437	PP_00596; YjjG family noncanonical pyrimidine nucleotidase	Show
592	642499..643152	PP_00597; uracil-DNA glycosylase	Show
593	643162..643626	PP_00598; 8-oxo-dGTP diphosphatase	Show
594	643639..644907	PP_00599; dihydroorotase	Show
595	644949..646289	PP_00600; MATE family efflux transporter	Show
596	646469..647437	PP_00601; thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha	Show
597	647453..648445	PP_00602; alpha-ketoacid dehydrogenase subunit beta	Show
598	648896..649939	PP_00603; dihydrolipoamide acetyltransferase	Show
599	650003..651688	PP_00604; dihydrolipoyl dehydrogenase	Show
600	651748..652737	PP_00605; lipoate--protein ligase	Show
601	652812..653882	PP_00606; tyrosine recombinase XerS	Show
602	654022..654312	PP_00607; hypothetical protein	Show
603	654293..654685	PP_00608; hypothetical protein	Show
604	654667..655899	PP_00609; hypothetical protein	Show
605	655899..656342	PP_00610; hypothetical protein	Show
606	656384..656749	PP_00611; hypothetical protein	Show
607	656749..657183	PP_00612; hypothetical protein	Show
608	657333..658883	PP_00613; chloride channel protein	Show
609	658896..659675	PP_00614; ribonuclease HII	Show
610	659662..660513	PP_00615; ribosome biogenesis GTPase YlqF	Show
611	660725..660940	PP_00616; AbrB family transcriptional regulator	Show
612	660924..661280	PP_00617; type II toxin-antitoxin system PemK/MazF family toxin	Show
613	661314..662492	PP_00618; hypothetical protein	Show
614	662510..666163	PP_00619; helicase-exonuclease AddAB subunit AddA	Show
615	666160..669435	PP_00620; ATP-dependent nuclease subunit B	Show
616	669542..669961	PP_00621; EVE domain-containing protein	Show
617	669954..670415	PP_00622; MarR family transcriptional regulator	Show
618	670562..671371	PP_00623; Cof-type HAD-IIB family hydrolase	Show
619	671416..672153	PP_00624; conjugal transfer protein TraX	Show
620	673510..674226	PP_00626; alpha/beta hydrolase	Show
621	674230..674541	PP_00627; hypothetical protein	Show
622	674655..675536	PP_00628; diacylglycerol kinase family lipid kinase	Show
623	676824..677450	PP_00630; SAP domain-containing protein	Show
624	677695..678501	PP_00631; alpha/beta hydrolase	Show
625	678705..679322	PP_00632; RpiB/LacA/LacB family sugar-phosphate isomerase	Show
626	679656..680240	PP_00634; hypothetical protein	Show
627	680246..681133	PP_00635; nucleotidyltransferase	Show
628	681268..681699	PP_00636; zinc ribbon domain-containing protein	Show
629	681873..682208	PP_00638; imsC-like protein	Show
630	682221..682589	PP_00639; hypothetical protein	Show
631	682576..682875	PP_00640; hypothetical protein	Show
632	682993..684456	PP_00641; ABC-F type ribosomal protection protein Msr(D)	Show
633	684576..685793	PP_00642; macrolide efflux MFS transporter Mef(A)	Show
634	686179..686349	PP_00643; DNA recombinase	Show
635	686864..688219	PP_00644; 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	Show
636	688293..689267	PP_00645; DUF1002 domain-containing protein	Show
637	689355..689957	PP_00646; lysozyme family protein	Show
638	689957..690931	PP_00647; nucleoid-associated protein	Show
639	690939..692195	PP_00648; serine hydroxymethyltransferase	Show
640	692245..692676	PP_00649; GNAT family N-acetyltransferase	Show
641	692678..693280	PP_00650; threonylcarbamoyl-AMP synthase	Show
642	693264..694100	PP_00651; peptide chain release factor N(5)-glutamine methyltransferase	Show
643	694100..695179	PP_00652; peptide chain release factor 1	Show
644	695189..695668	PP_00653; GNAT family N-acetyltransferase	Show
645	695658..696257	PP_00654; thymidine kinase	Show
646	696380..696562	PP_00655; 4-oxalocrotonate tautomerase	Show
647	696697..698070	PP_00656; tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	Show
648	698117..699052	PP_00657; 4-hydroxy-tetrahydrodipicolinate synthase	Show
649	699107..700183	PP_00658; aspartate-semialdehyde dehydrogenase	Show
650	700585..700657	tRNA-Thr	Show
651	700763..701272	PP_00659; QueT transporter family protein	Show
652	701395..701832	PP_00660; GtrA family protein	Show
653	701912..702292	PP_00661; large conductance mechanosensitive channel protein MscL	Show
654	702334..703347	PP_00662; ferrochelatase	Show
655	703490..704713	PP_00663; peptidase T	Show
656	704750..708139	PP_00664; pneumococcal-type histidine triad protein	Show
657	708147..709064	PP_00665; metal ABC transporter substrate-binding protein	Show
658	709261..711810	PP_00666; pneumococcal-type histidine triad protein	Show
659	712069..713802	PP_00667; phosphoenolpyruvate--protein phosphotransferase	Show
660	713808..714071	PP_00668; phosphocarrier protein HPr	Show
661	714526..715746	PP_00669; alpha/beta hydrolase	Show
662	716398..716616	PP_00670; glutaredoxin-like protein NrdH	Show
663	716703..718862	PP_00671; class 1b ribonucleoside-diphosphate reductase subunit alpha	Show
664	719057..720019	PP_00672; class 1b ribonucleoside-diphosphate reductase subunit beta	Show
665	720165..720932	PP_00673; DeoR/GlpR family DNA-binding transcription regulator	Show
666	720972..722378	PP_00674; 6-phospho-beta-galactosidase	Show
667	722463..724157	PP_00675; lactose-specific PTS transporter subunit EIIC	Show
668	724157..724474	PP_00676; PTS lactose/cellobiose transporter subunit IIA	Show
669	724510..725346	PP_00677; transcription antiterminator	Show
670	725582..726562	PP_00678; tagatose-bisphosphate aldolase	Show
671	726564..727493	PP_00679; tagatose-6-phosphate kinase	Show
672	727504..728019	PP_00680; galactose-6-phosphate isomerase subunit LacB	Show
673	728050..728475	PP_00681; galactose-6-phosphate isomerase subunit LacA	Show
674	728762..729658	PP_00682; aldose 1-epimerase family protein	Show
675	729762..731237	PP_00683; PTS galactitol transporter subunit IIC	Show
676	731292..731597	PP_00684; PTS sugar transporter subunit IIB	Show
677	731635..732111	PP_00685; PTS sugar transporter subunit IIA	Show
678	732304..732993	PP_00686; NTP transferase domain-containing protein	Show
679	733005..733883	PP_00687; DMT family transporter	Show
680	733885..734742	PP_00688; phosphotransferase family protein	Show
681	734759..735781	PP_00689; alcohol dehydrogenase catalytic domain-containing protein	Show
682	735786..736493	PP_00690; 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	Show
683	736918..737217	PP_00691; YbaB/EbfC family nucleoid-associated protein	Show
684	737257..739020	PP_00692; glycerophosphodiester phosphodiesterase	Show
685	739029..739619	PP_00693; 3'-5' exonuclease	Show
686	739701..740195	PP_00694; chromosome segregation protein RocS	Show
687	740272..740964	PP_00695; 5'-methylthioadenosine/adenosylhomocysteine nucleosidase	Show
688	740980..741291	PP_00696; cell wall synthase accessory phosphoprotein MacP	Show
689	741303..741848	PP_00697; NUDIX hydrolase	Show
690	741858..743237	PP_00698; bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	Show
691	743393..744193	PP_00699; glycoside hydrolase family 25 protein	Show
692	744299..745141	PP_00700; DUF368 domain-containing protein	Show
693	745141..745623	PP_00701; aminoacyl-tRNA deacylase	Show
694	745623..746246	PP_00702; histidine phosphatase family protein	Show
695	746383..747873	PP_00703; lysine--tRNA ligase	Show
696	748102..748941	PP_00704; amino acid ABC transporter substrate-binding protein	Show
697	748951..749580	PP_00705; amino acid ABC transporter ATP-binding protein	Show
698	749591..750232	PP_00706; amino acid ABC transporter permease	Show
699	750369..751598	PP_00707; tetratricopeptide repeat protein	Show
700	751588..752754	PP_00708; AI-2E family transporter	Show
701	755024..756037	PP_00710; lactonase family protein	Show
702	756081..756500	PP_00711; F0F1 ATP synthase subunit epsilon	Show
703	756511..757917	PP_00712; F0F1 ATP synthase subunit beta	Show
704	758003..758881	PP_00713; F0F1 ATP synthase subunit gamma	Show
705	758897..760402	PP_00714; F0F1 ATP synthase subunit alpha	Show
706	760417..760953	PP_00715; F0F1 ATP synthase subunit delta	Show
707	760953..761447	PP_00716; F0F1 ATP synthase subunit B	Show
708	761466..762182	PP_00717; F0F1 ATP synthase subunit A	Show
709	762215..762415	PP_00718; F0F1 ATP synthase subunit C	Show
710	762647..762958	PP_00719; hypothetical protein	Show
711	762973..764259	PP_00720; U32 family peptidase	Show
712	764397..765095	PP_00721; GntR family transcriptional regulator	Show
713	765236..766798	PP_00722; glutamine-hydrolyzing GMP synthase	Show
714	766872..768443	PP_00723; signal recognition particle protein	Show
715	768455..768787	PP_00724; putative DNA-binding protein	Show
716	768929..770125	PP_00725; elongation factor Tu	Show
717	770355..771464	PP_00726; AI-2E family transporter	Show
718	771569..772810	PP_00727; D-alanyl-D-alanine carboxypeptidase PBP3	Show
719	772840..773385	PP_00728; thiol-disulfide oxidoreductase-associated lipoprotein SdbB	Show
720	773398..774105	PP_00729; thiol-disulfide oxidoreductase-associated membrane protein CcdA2	Show
721	774233..775093	PP_00730; methionyl aminopeptidase	Show
722	775109..776386	PP_00731; CBS-HotDog domain-containing transcription factor SpxR	Show
723	776379..776930	PP_00732; GNAT family N-acetyltransferase	Show
724	776946..778205	PP_00733; UDP-N-acetylglucosamine 1-carboxyvinyltransferase	Show
725	778365..779870	PP_00734; pyruvate kinase	Show
726	779935..780942	PP_00735; 6-phosphofructokinase	Show
727	781022..784123	PP_00736; DNA polymerase III subunit alpha	Show
728	784510..786783	PP_00737; Xaa-Pro dipeptidyl-peptidase	Show
729	786802..787272	PP_00738; arginine repressor	Show
730	787308..787472	PP_00739; hypothetical protein	Show
731	787482..788792	PP_00740; GTPase ObgE	Show
732	788864..788998	PP_00741; DUF4044 domain-containing protein	Show
733	789029..789217	PP_00742; PspC domain-containing protein	Show
734	789238..790563	PP_00743; glycosyltransferase family 4 protein	Show
735	790572..791615	PP_00744; glycosyltransferase family 4 protein	Show
736	791728..792057	PP_00745; metal-sulfur cluster assembly factor	Show
737	792072..793181	PP_00746; RNA polymerase sigma factor RpoD	Show
738	793184..794944	PP_00747; DNA primase	Show
739	795138..795569	PP_00748; hypothetical protein	Show
740	795838..796596	PP_00749; ABC transporter ATP-binding protein	Show
741	796593..797459	PP_00750; ABC transporter permease	Show
742	797525..798520	PP_00751; ABC transporter substrate-binding protein	Show
743	798949..801645	PP_00752; phosphoenolpyruvate carboxylase	Show
744	801669..802892	PP_00753; FtsW/RodA/SpoVE family cell cycle protein	Show
745	803080..804021	PP_00754; peptidylprolyl isomerase PrsA	Show
746	804089..804802	PP_00755; O-methyltransferase	Show
747	804804..806606	PP_00756; oligoendopeptidase F	Show
748	806625..807581	PP_00757; competence protein CoiA	Show
749	807658..808806	PP_00758; DUF1887 family protein	Show
750	808984..809844	PP_00759; SAM-dependent methyltransferase TehB	Show
751	809859..810326	PP_00760; SsrA-binding protein SmpB	Show
752	810289..812643	PP_00761; ribonuclease R	Show
753	812740..812973	PP_00762; preprotein translocase subunit SecG	Show
754	813013..813162	PP_00763; 50S ribosomal protein L33	Show
755	813162..814361	PP_00764; multidrug efflux MFS transporter	Show
756	814348..814953	PP_00765; dephospho-CoA kinase	Show
757	814953..815777	PP_00766; DNA-formamidopyrimidine glycosylase	Show
758	815826..816725	PP_00767; GTPase Era	Show
759	816742..817137	PP_00768; diacylglycerol kinase	Show
760	817118..817615	PP_00769; rRNA maturation RNase YbeY	Show
761	817720..819375	PP_00770; Rqc2 family fibronectin-binding protein PavA	Show
762	819576..820307	PP_00771; NAD-dependent protein deacylase	Show
763	820452..821162	PP_00772; purine-nucleoside phosphorylase	Show
764	821623..822333	PP_00773; type 1 glutamine amidotransferase	Show
765	822330..823565	PP_00774; chloride channel protein	Show
766	823570..824379	PP_00775; purine-nucleoside phosphorylase	Show
767	824376..824936	PP_00776; DUF1697 domain-containing protein	Show
768	824938..826149	PP_00777; phosphopentomutase	Show
769	826170..826853	PP_00778; ribose-5-phosphate isomerase RpiA	Show
770	826959..827888	PP_00779; U32 family peptidase	Show
771	828015..828695	PP_00780; ABC transporter ATP-binding protein	Show
772	828709..829764	PP_00781; ABC transporter permease	Show
773	830150..830434	PP_00782; DUF3270 domain-containing protein	Show
774	830499..831836	PP_00783; HAMP domain-containing histidine kinase	Show
775	831826..832500	PP_00784; two-component system response regulator CiaR	Show
776	832610..835156	PP_00785; M1 family metallopeptidase	Show
777	835277..835717	PP_00786; ASCH domain-containing protein	Show
778	835742..836338	PP_00787; hypothetical protein	Show
779	836724..837224	PP_00789; NUDIX hydrolase	Show
780	837235..837933	PP_00790; 3-oxoacyl-ACP reductase	Show
781	837926..838162	PP_00791; DUF2829 domain-containing protein	Show
782	838276..839091	PP_00792; EbhA	Show
783	839206..840249	PP_00793; DNA/RNA non-specific endonuclease	Show
784	840417..842669	PP_00794; glucosaminidase domain-containing protein	Show
785	842780..843766	PP_00795; dihydroorotate dehydrogenase	Show
786	843729..844529	PP_00796; dihydroorotate dehydrogenase electron transfer subunit	Show
787	844774..845154	PP_00797; VOC family protein	Show
788	845252..848023	PP_00798; J domain-containing protein	Show
789	848037..849701	PP_00799; molecular chaperone HscC	Show
790	849876..850235	PP_00800; 50S ribosomal protein L20	Show
791	850287..850487	PP_00801; 50S ribosomal protein L35	Show
792	850520..851050	PP_00802; translation initiation factor IF-3	Show
793	851271..853511	PP_00803; DNA internalization-related competence protein ComEC/Rec2	Show
794	853495..854145	PP_00804; helix-hairpin-helix domain-containing protein	Show
795	854212..854781	PP_00805; GNAT family N-acetyltransferase	Show
796	854958..856070	PP_00806; alanine dehydrogenase	Show
797	856259..857147	PP_00807; G5 domain-containing protein	Show
798	857148..860387	PP_00808; LPXTG cell wall anchor domain-containing protein	Show
799	860607..861833	PP_00809; glycosyltransferase family 8 protein	Show
800	861849..863078	PP_00810; glycosyl hydrolase family 8	Show
801	863168..864385	PP_00811; accessory Sec system protein translocase subunit SecY2	Show
802	864395..865975	PP_00812; accessory Sec system protein Asp1	Show
803	865959..867488	PP_00813; accessory Sec system protein Asp2	Show
804	867485..867925	PP_00814; accessory Sec system protein Asp3	Show
805	867918..870290	PP_00815; accessory Sec system translocase SecA2	Show
806	870303..871823	PP_00816; accessory Sec system glycosyltransferase GtfA	Show
807	871807..873153	PP_00817; accessory Sec system glycosylation chaperone GtfB	Show
808	873146..873325	PP_00818; accessory secretory system protein Asp4	Show
809	873328..873552	PP_00819; accessory secretory protein Asp5	Show
810	873961..874914	PP_00821; aromatic acid exporter family protein	Show
811	874964..876175	PP_00822; serine/threonine transporter SstT	Show
812	876326..876892	PP_00823; mechanosensitive ion channel family protein	Show
813	876944..877849	PP_00824; magnesium transporter CorA family protein	Show
814	877866..878393	PP_00825; YqeG family HAD IIIA-type phosphatase	Show
815	878396..879502	PP_00826; ribosome biogenesis GTPase YqeH	Show
816	879716..880027	PP_00827; ribosome assembly RNA-binding protein YhbY	Show
817	880079..880708	PP_00828; nicotinate-nucleotide adenylyltransferase	Show
818	880708..881301	PP_00829; bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK	Show
819	881302..881655	PP_00830; ribosome silencing factor	Show
820	882107..882847	PP_00831; class I SAM-dependent methyltransferase	Show
821	882857..883954	PP_00832; nucleotidyltransferase	Show
822	884087..884341	PP_00833; type II toxin-antitoxin system Phd/YefM family antitoxin	Show
823	884345..884599	PP_00834; Txe/YoeB family addiction module toxin	Show
824	884802..886487	PP_00835; NTPase	Show
825	886622..888235	PP_00836; ribonuclease Y	Show
826	888370..888996	PP_00837; guanylate kinase	Show
827	889021..889335	PP_00838; DNA-directed RNA polymerase subunit omega	Show
828	889401..891797	PP_00839; primosomal protein N'	Show
829	891810..892745	PP_00840; methionyl-tRNA formyltransferase	Show
830	892738..894051	PP_00841; 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	Show
831	894067..894807	PP_00842; Stp1/IreP family PP2C-type Ser/Thr phosphatase	Show
832	894804..896684	PP_00843; Stk1 family PASTA domain-containing Ser/Thr kinase	Show
833	896770..897528	PP_00844; threonine/serine exporter family protein	Show
834	897530..897985	PP_00845; threonine/serine exporter family protein	Show
835	898104..899276	PP_00846; hydroxymethylglutaryl-CoA synthase	Show
836	899276..900550	PP_00847; hydroxymethylglutaryl-CoA reductase, degradative	Show
837	900585..901550	PP_00848; LacI family DNA-binding transcriptional regulator	Show
838	901531..902985	PP_00849; sucrose-6-phosphate hydrolase	Show
839	903365..905302	PP_00850; sucrose-specific PTS transporter subunit IIBC	Show
840	905461..906348	PP_00851; ROK family protein	Show
841	906668..907285	PP_00852; TVP38/TMEM64 family protein	Show
842	910110..911273	PP_00854; bacteriophage abortive infection AbiH family protein;phage abortive infection AbiH family protein	Show
843	911380..912948	PP_00855; type I restriction-modification system subunit M	Show
844	912941..913945	PP_00856; virulence RhuM family protein	Show
845	913945..915750	PP_00857; restriction endonuclease subunit S	Show
846	915807..918851	PP_00858; type I restriction endonuclease subunit R	Show
847	918976..919377	PP_00859; YbgA family protein	Show
848	919361..919723	PP_00860; TIGR02328 family protein	Show
849	919968..922217	PP_00861; 5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	Show
850	922312..923178	PP_00862; methylenetetrahydrofolate reductase	Show
851	923546..925759	PP_00863; polyribonucleotide nucleotidyltransferase	Show
852	925775..926392	PP_00864; serine O-acetyltransferase	Show
853	926404..927270	PP_00865; GNAT family N-acetyltransferase	Show
854	927275..928036	PP_00866; nucleoside phosphorylase	Show
855	928080..929423	PP_00867; cysteine--tRNA ligase	Show
856	929416..929802	PP_00868; Mini-ribonuclease 3	Show
857	929806..930675	PP_00869; PucR family transcriptional regulator	Show
858	930789..931919	PP_00870; sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	Show
859	932063..934279	PP_00871; bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	Show
860	934309..934752	PP_00872; D-tyrosyl-tRNA(Tyr) deacylase	Show
861	934783..935196	PP_00873; hypothetical protein	Show
862	935304..935954	PP_00874; metal-dependent transcriptional regulator	Show
863	936038..936532	PP_00875; thiol peroxidase	Show
864	936655..937584	PP_00876; metal ABC transporter substrate-binding protein	Show
865	937617..938465	PP_00877; metal ABC transporter permease	Show
866	938462..939184	PP_00878; metal ABC transporter ATP-binding protein	Show
867	939363..941255	PP_00879; M13 family metallopeptidase	Show
868	941294..941923	PP_00880; MBL fold metallo-hydrolase	Show
869	941987..943081	PP_00881; DUF2974 domain-containing protein	Show
870	943171..943947	PP_00882; ferredoxin reductase	Show
871	944033..944602	PP_00883; TetR/AcrR family transcriptional regulator	Show
872	944923..945600	PP_00884; response regulator transcription factor	Show
873	945593..946567	PP_00885; sensor histidine kinase	Show
874	946615..948558	PP_00886; threonine--tRNA ligase	Show
875	948891..949265	PP_00887; hypothetical protein	Show
876	949463..950305	PP_00888; metallophosphoesterase family protein	Show
877	950378..950815	PP_00889; Rrf2 family transcriptional regulator	Show
878	950883..951905	PP_00890; YdcF family protein	Show
879	952058..952648	PP_00891; hypothetical protein	Show
880	953059..953271	PP_00892; AbrB/MazE/SpoVT family DNA-binding domain-containing protein	Show
881	953273..954007	PP_00893; ABC transporter ATP-binding protein	Show
882	954007..954657	PP_00894; ABC-2 transporter permease	Show
883	954959..955618	PP_00895; amino acid ABC transporter permease	Show
884	955628..956305	PP_00896; amino acid ABC transporter permease	Show
885	956318..957112	PP_00897; transporter substrate-binding domain-containing protein	Show
886	957123..957881	PP_00898; amino acid ABC transporter ATP-binding protein	Show
887	958059..960281	PP_00899; single-stranded-DNA-specific exonuclease RecJ	Show
888	960455..962116	PP_00900; ribonuclease J	Show
889	962185..962964	PP_00901; esterase family protein	Show
890	963069..963770	PP_00902; matrixin family metalloprotease	Show
891	963862..965709	PP_00903; excinuclease ABC subunit UvrC	Show
892	965699..966553	PP_00904; metallophosphatase family protein	Show
893	966840..967247	PP_00905; hypothetical protein	Show
894	967252..967581	PP_00906; hypothetical protein	Show
895	967702..968094	PP_00907; hypothetical protein	Show
896	968094..969311	PP_00908; triacylglycerol lipase	Show
897	969293..969685	PP_00909; hypothetical protein	Show
898	969666..969959	PP_00910; hypothetical protein	Show
899	970103..970708	PP_00911; nitroreductase family protein	Show
900	970721..972121	PP_00912; dipeptidase PepV	Show
901	972175..972765	PP_00913; uracil-DNA glycosylase family protein	Show
902	972762..973049	PP_00914; rhodanese-like domain-containing protein	Show
903	973235..974560	PP_00915; branched-chain amino acid transport system II carrier protein	Show
904	974609..975160	PP_00916; YehR family protein	Show
905	975300..976337	PP_00917; M42 family metallopeptidase	Show
906	976339..976800	PP_00918; HIT family protein	Show
907	976816..977532	PP_00919; M15 family metallopeptidase	Show
908	977655..978080	PP_00920; 50S ribosomal protein L11	Show
909	978288..978977	PP_00921; 50S ribosomal protein L1	Show
910	979153..979665	PP_00922; adenine phosphoribosyltransferase	Show
911	979847..980791	PP_00923; homoserine O-succinyltransferase	Show
912	980800..981477	PP_00924; DnaD domain-containing protein	Show
913	981574..982332	PP_00925; triose-phosphate isomerase	Show
914	982512..984248	PP_00926; ABC transporter ATP-binding protein/permease	Show
915	984257..986038	PP_00927; ABC transporter ATP-binding protein/permease	Show
916	986188..986706	PP_00928; DNA starvation/stationary phase protection protein	Show
917	986917..987255	PP_00929; alkylphosphonate utilization protein	Show
918	987258..987881	PP_00930; Pr6Pr family membrane protein	Show
919	987994..989145	PP_00931; MFS transporter	Show
920	989245..989994	PP_00932; tRNA pseudouridine(38-40) synthase TruA	Show
921	989984..990757	PP_00933; bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	Show
922	990735..991196	PP_00934; ECF transporter S component	Show
923	991405..992487	PP_00935; Xaa-Pro peptidase family protein	Show
924	992615..993397	PP_00936; type 1 glutamine amidotransferase	Show
925	993397..994740	PP_00937; Mur ligase family protein	Show
926	994839..996155	PP_00938; FAD-containing oxidoreductase	Show
927	996504..998066	PP_00939; DEAD/DEAH box helicase	Show
928	998349..999137	PP_00940; GTP-sensing pleiotropic transcriptional regulator CodY	Show
929	999137..999712	PP_00941; cysteine hydrolase	Show
930	999793..999878	tRNA-Leu	Show
931	1000273..1001550	PP_00942; ABC transporter permease	Show
932	1001563..1002210	PP_00943; ABC transporter ATP-binding subunit Vex2	Show
933	1002261..1003640	PP_00944; ABC transporter permease subunit Vex3	Show
934	1003781..1004437	PP_00945; response regulator transcription factor VncR	Show
935	1004434..1005762	PP_00946; sensor histidine kinase VncS	Show
936	1005901..1006782	PP_00947; fructose-bisphosphate aldolase	Show
937	1006910..1007842	PP_00948; alpha/beta hydrolase	Show
938	1007894..1008439	PP_00949; histidine phosphatase family protein	Show
939	1008758..1009750	PP_00950; ATP-binding cassette domain-containing protein	Show
940	1009752..1010570	PP_00951; ABC-2 family transporter protein	Show
941	1010572..1011357	PP_00952; ABC transporter permease	Show
942	1011458..1011530	tRNA-Thr	Show
943	1011722..1012030	PP_00953; hypothetical protein	Show
944	1012068..1013867	PP_00954; N-acetylmuramoyl-L-alanine amidase	Show
945	1013898..1014806	PP_00955; LysR family transcriptional regulator	Show
946	1014909..1015139	PP_00956; YqgQ family protein	Show
947	1015139..1015519	PP_00957; rhodanese-like domain-containing protein	Show
948	1015606..1015866	PP_00958; DUF4190 domain-containing protein	Show
949	1015908..1016633	PP_00959; rRNA pseudouridine synthase	Show
950	1016794..1018635	PP_00960; translational GTPase TypA	Show
951	1018655..1018909	PP_00961; DUF3165 family protein	Show
952	1019342..1021363	PP_00962; bacteriocin-associated integral membrane family protein	Show
953	1021365..1022006	PP_00963; ABC transporter ATP-binding protein	Show
954	1022110..1023462	PP_00964; UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	Show
955	1023464..1024522	PP_00965; UDP-N-acetylglucosamine--N-acetylmuramyl- (pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase	Show
956	1024532..1025683	PP_00966; FtsQ-type POTRA domain-containing protein	Show
957	1025930..1026625	PP_00967; orotidine-5'-phosphate decarboxylase	Show
958	1026665..1027297	PP_00968; orotate phosphoribosyltransferase	Show
959	1027348..1027971	PP_00969; cysteine hydrolase	Show
960	1028225..1028785	PP_00970; TetR/AcrR family transcriptional regulator	Show
961	1028958..1029272	PP_00971; hypothetical protein	Show
962	1029293..1029598	PP_00972; hypothetical protein	Show
963	1029759..1030895	PP_00973; L-lactate oxidase	Show
964	1031291..1031851	PP_00974; ECF transporter S component	Show
965	1031852..1033237	PP_00975; energy-coupling factor ABC transporter ATP-binding protein	Show
966	1033239..1033889	PP_00976; energy-coupling factor transporter transmembrane protein EcfT	Show
967	1033900..1034592	PP_00977; thiaminase II	Show
968	1034596..1035120	PP_00978; energy coupling factor transporter S component ThiW	Show
969	1035120..1035923	PP_00979; hydroxyethylthiazole kinase	Show
970	1035916..1036548	PP_00980; thiamine phosphate synthase	Show
971	1036595..1037386	PP_00981; bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	Show
972	1037753..1038148	PP_00982; CopY/TcrY family copper transport repressor	Show
973	1038159..1038530	PP_00983; cupredoxin domain-containing protein	Show
974	1038540..1040783	PP_00984; heavy metal translocating P-type ATPase	Show
975	1041146..1042921	PP_00985; pyruvate oxidase	Show
976	1043032..1043379	PP_00986; VOC family protein	Show
977	1043541..1044485	PP_00987; mannose-6-phosphate isomerase, class I	Show
978	1046232..1046972	PP_00989; MerR family transcriptional regulator	Show
979	1047017..1047538	PP_00990; DUF1697 domain-containing protein	Show
980	1047552..1048772	PP_00991; NAD(P)/FAD-dependent oxidoreductase	Show
981	1048791..1049636	PP_00992; DegV family protein	Show
982	1049761..1050318	PP_00993; TetR/AcrR family transcriptional regulator	Show
983	1050337..1050804	PP_00994; cytidine/deoxycytidylate deaminase family protein	Show
984	1050893..1051522	PP_00995; uracil phosphoribosyltransferase	Show
985	1051696..1052286	PP_00996; ATP-dependent Clp protease proteolytic subunit	Show
986	1052365..1052634	PP_00997; YlbG family protein	Show
987	1052723..1053883	PP_00998; ABC transporter substrate-binding protein	Show
988	1054004..1054873	PP_00999; branched-chain amino acid ABC transporter permease	Show
989	1054877..1055833	PP_01000; branched-chain amino acid ABC transporter permease	Show
990	1055833..1056597	PP_01001; ABC transporter ATP-binding protein	Show
991	1056597..1057307	PP_01002; ABC transporter ATP-binding protein	Show
992	1057648..1058304	PP_01003; CBS domain-containing protein	Show
993	1058415..1059510	PP_01004; peptide chain release factor 2	Show
994	1059528..1060220	PP_01005; cell division ATP-binding protein FtsE	Show
995	1060213..1061139	PP_01006; permease-like cell division protein FtsX	Show
996	1061357..1063543	PP_01007; PTS transporter subunit IIBC	Show
997	1063595..1064410	PP_01008; endonuclease/exonuclease/phosphatase family protein	Show
998	1064514..1065857	PP_01009; DEAD/DEAH box helicase	Show
999	1066054..1067247	PP_01010; methionine adenosyltransferase	Show
1000	1067356..1067655	PP_01011; DUF1827 family protein	Show
1001	1067714..1068166	PP_01012; NUDIX hydrolase	Show
1002	1068343..1069245	PP_01013; YafY family transcriptional regulator	Show
1003	1069300..1069914	PP_01014; GyrI-like domain-containing protein	Show
1004	1069957..1072218	PP_01015; ATP-dependent Clp protease ATP-binding subunit	Show
1005	1072456..1072686	PP_01016; DUF1797 family protein	Show
1006	1072878..1073561	PP_01017; amino acid ABC transporter permease	Show
1007	1073561..1074295	PP_01018; amino acid ABC transporter ATP-binding protein	Show
1008	1074329..1074649	PP_01019; TfoX/Sxy family protein	Show
1009	1074798..1075655	PP_01020; bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	Show
1010	1075660..1076433	PP_01021; HAD family hydrolase	Show
1011	1076489..1077340	PP_01022; NAD(P)H-hydrate dehydratase	Show
1012	1077538..1080030	PP_01023; bifunctional DnaQ family exonuclease/ATP-dependent helicase	Show
1013	1080036..1081259	PP_01024; FtsW/RodA/SpoVE family cell cycle protein	Show
1014	1081270..1081824	PP_01025; DJ-1/PfpI family protein	Show
1015	1081899..1082471	PP_01026; HAD-IA family hydrolase	Show
1016	1082485..1084431	PP_01027; DNA topoisomerase (ATP-hydrolyzing) subunit B	Show
1017	1084512..1086239	PP_01028; septation ring formation regulator EzrA	Show
1018	1086342..1087730	PP_01029; polysaccharide deacetylase family protein	Show
1019	1087812..1088654	PP_01030; aldo/keto reductase	Show
1020	1088941..1093452	PP_01031; S8 family serine peptidase	Show
1021	1093773..1094534	PP_01032; elongation factor Tu	Show
1022	1094727..1095644	PP_01033; glycine--tRNA ligase subunit alpha	Show
1023	1095856..1097892	PP_01034; glycine--tRNA ligase subunit beta	Show
1024	1097937..1098194	PP_01035; DUF896 family protein	Show
1025	1098277..1099521	PP_01036; NAD(P)H-dependent oxidoreductase	Show
1026	1099539..1100144	PP_01037; NAD(P)H-dependent oxidoreductase	Show
1027	1100163..1101125	PP_01038; FAD:protein FMN transferase	Show
1028	1101400..1102779	PP_01039; FAD-dependent oxidoreductase	Show
1029	1102932..1103807	PP_01040; pyridoxal 5'-phosphate synthase lyase subunit PdxS	Show
1030	1103808..1104389	PP_01041; pyridoxal 5'-phosphate synthase glutaminase subunit PdxT	Show
1031	1104409..1105056	PP_01042; hemolysin III family protein	Show
1032	1105634..1106128	PP_01044; GNAT family N-acetyltransferase	Show
1033	1106125..1106640	PP_01045; methylated-DNA--[protein]-cysteine S-methyltransferase	Show
1034	1106653..1107009	PP_01046; arsenate reductase family protein	Show
1035	1107166..1107966	PP_01047; amino acid ABC transporter permease	Show
1036	1107966..1108709	PP_01048; amino acid ABC transporter ATP-binding protein	Show
1037	1108787..1109011	PP_01049; DUF4059 family protein	Show
1038	1109077..1109988	PP_01050; thioredoxin-disulfide reductase	Show
1039	1110178..1110906	PP_01051; 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	Show
1040	1110951..1111562	PP_01052; peptide deformylase	Show
1041	1111718..1113037	PP_01053; CapA family protein	Show
1042	1113061..1113888	PP_01054; Cof-type HAD-IIB family hydrolase	Show
1043	1113890..1114525	PP_01055; 1-alkyl-2-acetylglycerophosphocholine esterase	Show
1044	1114586..1114930	tmRNA,Resume consensus sequence (at 76): tataactgcaaaaaataa	Show
1045	1115090..1115177	tRNA-Ser	Show
1046	1115340..1116080	PP_01056; DeoR/GlpR family DNA-binding transcription regulator	Show
1047	1116077..1116988	PP_01057; 1-phosphofructokinase	Show
1048	1116985..1118937	PP_01058; fructose-specific PTS transporter subunit EIIC	Show
1049	1119024..1121330	PP_01059; DNA translocase FtsK	Show
1050	1121375..1121803	PP_01060; hypothetical protein	Show
1051	1121941..1123083	PP_01061; cysteine desulfurase	Show
1052	1123092..1124306	PP_01062; tRNA 4-thiouridine(8) synthase ThiI	Show
1053	1124443..1125267	PP_01063; alpha/beta hydrolase	Show
1054	1125288..1126028	PP_01064; esterase family protein	Show
1055	1126041..1127207	PP_01065; ATP-grasp domain-containing protein	Show
1056	1127365..1128234	PP_01066; aquaporin family protein	Show
1057	1128344..1129069	PP_01067; CppA family protein	Show
1058	1129066..1130001	PP_01068; beta-lactamase family protein	Show
1059	1130010..1130915	PP_01069; DMT family transporter	Show
1060	1130960..1132243	PP_01070; NCS2 family nucleobase:cation symporter	Show
1061	1132516..1133229	PP_01071; 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	Show
1062	1133323..1133883	PP_01072; LemA family protein	Show
1063	1133885..1134784	PP_01073; zinc metalloprotease HtpX	Show
1064	1134896..1135492	PP_01074; CPBP family intramembrane metalloprotease	Show
1065	1135676..1137235	PP_01075; ATP-binding cassette domain-containing protein	Show
1066	1137566..1137895	PP_01076; helicase BlpT	Show
1067	1138064..1138606	PP_01077; DUF177 domain-containing protein	Show
1068	1138607..1139236	PP_01078; endonuclease III	Show
1069	1139447..1139968	PP_01079; bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR	Show
1070	1139987..1140910	PP_01080; aspartate carbamoyltransferase catalytic subunit	Show
1071	1140960..1142039	PP_01081; carbamoyl phosphate synthase small subunit	Show
1072	1142488..1145664	PP_01082; carbamoyl-phosphate synthase large subunit	Show
1073	1146114..1147448	PP_01083; Nramp family divalent metal transporter	Show
1074	1147565..1147849	PP_01084; type B 50S ribosomal protein L31	Show
1075	1147903..1148838	PP_01085; bifunctional oligoribonuclease/PAP phosphatase NrnA	Show
1076	1148942..1149385	PP_01086; flavodoxin	Show
1077	1149503..1149769	PP_01087; chorismate mutase	Show
1078	1149766..1150140	PP_01088; fluoride efflux transporter CrcB	Show
1079	1150134..1150463	PP_01089; fluoride efflux transporter CrcB	Show
1080	1150582..1150929	PP_01090; 50S ribosomal protein L19	Show
1081	1150972..1151043	tRNA-Arg	Show
1082	1151710..1154514	PP_01091; cation-transporting P-type ATPase	Show
1083	1157040..1157846	PP_01096; sugar-phosphatase	Show
1084	1157856..1159163	PP_01097; HD domain-containing protein	Show
1085	1159235..1159612	PP_01098; DUF1934 domain-containing protein	Show
1086	1159637..1160719	PP_01099; DEAD/DEAH box helicase	Show
1087	1160716..1161693	PP_01100; Gfo/Idh/MocA family oxidoreductase	Show
1088	1161849..1162544	PP_01101; DUF1275 domain-containing protein	Show
1089	1162752..1163066	PP_01102; 50S ribosomal protein L21	Show
1090	1163083..1163427	PP_01103; ribosomal-processing cysteine protease Prp	Show
1091	1163444..1163737	PP_01104; 50S ribosomal protein L27	Show
1092	1163969..1164877	PP_01105; LysR family transcriptional regulator	Show
1093	1164874..1165341	PP_01106; signal peptidase II	Show
1094	1165325..1166224	PP_01107; RluA family pseudouridine synthase	Show
1095	1166326..1167435	PP_01108; glutamate 5-kinase	Show
1096	1167445..1168707	PP_01109; glutamate-5-semialdehyde dehydrogenase	Show
1097	1168711..1169508	PP_01110; pyrroline-5-carboxylate reductase	Show
1098	1169623..1170261	PP_01111; dTMP kinase	Show
1099	1170258..1171148	PP_01112; DNA polymerase III subunit delta'	Show
1100	1171294..1171611	PP_01113; DNA replication initiation control protein YabA	Show
1101	1171614..1172492	PP_01114; 16S rRNA (cytidine(1402)-2'-O)-methyltransferase	Show
1102	1172626..1173960	PP_01115; methylenetetrahydrofolate--tRNA-(uracil(54)- C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO	Show
1103	1174044..1174781	PP_01116; UMP kinase	Show
1104	1174789..1175346	PP_01117; ribosome recycling factor	Show
1105	1175406..1176260	PP_01118; RNA-binding virulence regulatory protein CvfB	Show
1106	1176272..1176877	PP_01119; GrpB family protein	Show
1107	1176874..1177089	PP_01120; YozE family protein	Show
1108	1177170..1178156	PP_01121; PhoH family protein	Show
1109	1178487..1179074	PP_01122; TlpA family protein disulfide reductase	Show
1110	1179133..1182030	PP_01123; isopeptide-forming domain-containing fimbrial protein	Show
1111	1182031..1182103	tRNA-Phe	Show
1112	1182119..1182189	tRNA-Gly	Show
1113	1182222..1182295	tRNA-Ile	Show
1114	1182302..1182389	tRNA-Ser	Show
1115	1183602..1184306	PP_01125; hypothetical protein	Show
1116	1184411..1185349	PP_01126; bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA	Show
1117	1185346..1186206	PP_01127; AraC family ligand binding domain-containing protein	Show
1118	1186314..1188476	PP_01128; alpha-galactosidase	Show
1119	1188511..1189761	PP_01129; extracellular solute-binding protein	Show
1120	1189780..1190652	PP_01130; sugar ABC transporter permease	Show
1121	1190669..1191502	PP_01131; carbohydrate ABC transporter permease	Show
1122	1191699..1193141	PP_01132; sucrose phosphorylase	Show
1123	1193275..1194468	PP_01133; O-antigen ligase family protein	Show
1124	1194613..1195056	PP_01134; MarR family transcriptional regulator	Show
1125	1195129..1195857	PP_01135; ABC transporter ATP-binding protein	Show
1126	1195850..1197370	PP_01136; ABC transporter permease/substrate-binding protein	Show
1127	1197813..1198415	PP_01137; ECF transporter S component	Show
1128	1198415..1199206	PP_01138; energy-coupling factor transporter transmembrane protein EcfT	Show
1129	1199182..1200018	PP_01139; energy-coupling factor ABC transporter ATP-binding protein	Show
1130	1200005..1200805	PP_01140; energy-coupling factor ABC transporter ATP-binding protein	Show
1131	1201420..1201677	PP_01141; plasmid replication protein	Show
1132	1201670..1201852	PP_01142; hypothetical protein	Show
1133	1201833..1202366	PP_01143; IS6 family transposase	Show
1134	1202946..1203278	PP_01145; glucuronide permease	Show
1135	1203305..1203859	PP_01146; TetR/AcrR family transcriptional regulator	Show
1136	1203992..1204882	PP_01147; cation diffusion facilitator family transporter	Show
1137	1204918..1205922	PP_01148; DNA-binding transcriptional regulator GalR	Show
1138	1206086..1207264	PP_01149; galactokinase	Show
1139	1207283..1208764	PP_01150; UDP-glucose--hexose-1-phosphate uridylyltransferase	Show
1140	1208834..1209238	PP_01151; PaaI family thioesterase	Show
1141	1209266..1210528	PP_01152; purine permease	Show
1142	1210528..1211109	PP_01153; xanthine phosphoribosyltransferase	Show
1143	1211556..1211942	PP_01154; VOC family protein	Show
1144	1211954..1212781	PP_01155; exodeoxyribonuclease III	Show
1145	1212915..1213370	PP_01156; DUF3290 domain-containing protein	Show
1146	1213367..1214002	PP_01157; DUF421 domain-containing protein	Show
1147	1214209..1215954	PP_01158; ABC transporter ATP-binding protein/permease	Show
1148	1215944..1217686	PP_01159; ABC transporter ATP-binding protein/permease	Show
1149	1217905..1218597	PP_01160; sugar transferase	Show
1150	1218640..1219866	PP_01161; DegT/DnrJ/EryC1/StrS aminotransferase family protein	Show
1151	1220296..1221474	PP_01162; tryptophan synthase subunit beta	Show
1152	1222075..1223436	PP_01163; anthranilate synthase component I	Show
1153	1223433..1223999	PP_01164; aminodeoxychorismate/anthranilate synthase component II	Show
1154	1224010..1225014	PP_01165; anthranilate phosphoribosyltransferase	Show
1155	1225011..1225778	PP_01166; indole-3-glycerol phosphate synthase TrpC	Show
1156	1225765..1226364	PP_01167; phosphoribosylanthranilate isomerase	Show
1157	1226342..1227565	PP_01168; tryptophan synthase subunit beta	Show
1158	1227558..1228334	PP_01169; tryptophan synthase subunit alpha	Show
1159	1228306..1228965	PP_01170; prepilin peptidase	Show
1160	1229036..1229491	PP_01171; GNAT family N-acetyltransferase	Show
1161	1229595..1230119	PP_01172; thiol-disulfide isomerase	Show
1162	1230189..1230710	PP_01173; hypothetical protein	Show
1163	1230931..1231134	PP_01174; CsbD family protein	Show
1164	1231176..1231760	PP_01175; Asp23/Gls24 family envelope stress response protein	Show
1165	1231772..1231942	PP_01176; DUF2273 domain-containing protein	Show
1166	1231954..1232517	PP_01177; alkaline shock response membrane anchor protein AmaP	Show
1167	1232617..1232853	PP_01178; GlsB/YeaQ/YmgE family stress response membrane protein	Show
1168	1233164..1234645	PP_01179; helix-turn-helix domain-containing protein	Show
1169	1235113..1236258	PP_01180; low temperature requirement protein A	Show
1170	1236473..1236889	PP_01181; helix-turn-helix domain-containing protein	Show
1171	1236918..1237523	PP_01182; DUF1269 domain-containing protein	Show
1172	1238291..1238806	PP_01183; DUF308 domain-containing protein	Show
1173	1239161..1239233	tRNA-Lys	Show
1174	1239498..1240769	PP_01184; replication-associated recombination protein A	Show
1175	1240885..1241355	PP_01185; DUF3013 family protein	Show
1176	1241365..1241793	PP_01186; NUDIX hydrolase	Show
1177	1241790..1242155	PP_01187; hypothetical protein	Show
1178	1242220..1242693	PP_01188; GNAT family N-acetyltransferase	Show
1179	1242831..1243781	PP_01189; 50S ribosomal protein L11 methyltransferase	Show
1180	1243783..1244526	PP_01190; 16S rRNA (uracil(1498)-N(3))-methyltransferase	Show
1181	1244537..1246333	PP_01191; oligoendopeptidase F	Show
1182	1247276..1248040	PP_01193; (S)-acetoin forming diacetyl reductase	Show
1183	1248294..1248962	PP_01194; aquaporin	Show
1184	1249020..1249511	PP_01195; preQ(1) synthase	Show
1185	1249529..1250245	PP_01196; 7-carboxy-7-deazaguanine synthase QueE	Show
1186	1250238..1250681	PP_01197; 6-carboxytetrahydropterin synthase QueD	Show
1187	1250681..1251334	PP_01198; 7-cyano-7-deazaguanine synthase QueC	Show
1188	1251538..1251852	PP_01199; thioredoxin	Show
1189	1251868..1252089	PP_01200; DUF4649 family protein	Show
1190	1252189..1252569	PP_01201; MarR family transcriptional regulator	Show
1191	1252766..1253140	PP_01202; CidA/LrgA family protein	Show
1192	1253137..1253832	PP_01203; LrgB family protein	Show
1193	1253864..1254592	PP_01204; hypothetical protein	Show
1194	1254608..1255303	PP_01205; ABC transporter ATP-binding protein	Show
1195	1255308..1255673	PP_01206; GntR family transcriptional regulator	Show
1196	1255814..1256287	PP_01207; transcriptional regulator NrdR	Show
1197	1256288..1257451	PP_01208; DnaD domain protein	Show
1198	1257452..1258348	PP_01209; primosomal protein DnaI	Show
1199	1258345..1259058	PP_01210; NADPH-dependent oxidoreductase	Show
1200	1259072..1260382	PP_01211; ribosome biogenesis GTPase Der	Show
1201	1260611..1261462	PP_01212; TPM domain-containing protein	Show
1202	1261613..1262209	PP_01213; LemA family protein	Show
1203	1262342..1262632	PP_01214; hypothetical protein	Show
1204	1262776..1265289	PP_01215; preprotein translocase subunit SecA	Show
1205	1265369..1266400	PP_01216; 3-deoxy-7-phosphoheptulonate synthase	Show
1206	1266402..1267433	PP_01217; 3-deoxy-7-phosphoheptulonate synthase	Show
1207	1267479..1267841	PP_01218; holo-ACP synthase	Show
1208	1267831..1268934	PP_01219; alanine racemase	Show
1209	1268953..1270968	PP_01220; ATP-dependent DNA helicase RecG	Show
1210	1271430..1271912	PP_01221; thioesterase	Show
1211	1272071..1273051	PP_01222; acetylxylan esterase	Show
1212	1273385..1276666	PP_01223; exo-alpha-sialidase	Show
1213	1276900..1277598	PP_01224; N-acetylmannosamine-6-phosphate 2-epimerase	Show
1214	1277713..1279041	PP_01225; ABC transporter substrate-binding protein	Show
1215	1279260..1280126	PP_01226; sugar ABC transporter permease	Show
1216	1280142..1280981	PP_01227; carbohydrate ABC transporter permease	Show
1217	1281255..1281707	PP_01228; YhcH/YjgK/YiaL family protein	Show
1218	1281728..1282372	PP_01229; YesL family protein	Show
1219	1282543..1283460	PP_01230; dihydrodipicolinate synthase family protein	Show
1220	1283478..1284362	PP_01231; ROK family protein	Show
1221	1284378..1285229	PP_01232; MurR/RpiR family transcriptional regulator	Show
1222	1285486..1287528	PP_01233; penicillin-binding protein PBP2B	Show
1223	1287539..1288135	PP_01234; recombination mediator RecR	Show
1224	1288440..1288715	PP_01235; TIGR04197 family type VII secretion effector	Show
1225	1288719..1289075	PP_01236; hypothetical protein	Show
1226	1289114..1290679	PP_01237; LXG domain-containing protein	Show
1227	1290666..1291193	PP_01238; thiol-disulfide isomerase	Show
1228	1291452..1292495	PP_01239; D-alanine--D-alanine ligase	Show
1229	1292581..1293954	PP_01240; UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	Show
1230	1293941..1294552	PP_01241; NUDIX hydrolase	Show
1231	1294749..1295453	PP_01242; TIGR02206 family membrane protein	Show
1232	1295687..1297057	PP_01243; cell division protein FtsA	Show
1233	1297074..1298330	PP_01244; cell division protein FtsZ	Show
1234	1298334..1299005	PP_01245; YggS family pyridoxal phosphate-dependent enzyme	Show
1235	1299015..1299545	PP_01246; cell division protein SepF	Show
1236	1299545..1299805	PP_01247; YggT family protein	Show
1237	1299802..1300593	PP_01248; RNA-binding protein	Show
1238	1300602..1301396	PP_01249; DivIVA domain-containing protein	Show
1239	1301650..1304442	PP_01250; isoleucine--tRNA ligase	Show
1240	1304770..1305150	PP_01251; hypothetical protein	Show
1241	1305339..1306031	PP_01252; phosphoglycerate mutase	Show
1242	1306324..1306593	PP_01253; 30S ribosomal protein S15	Show
1243	1307233..1307859	PP_01254; CadD family cadmium resistance transporter	Show
1244	1308003..1309049	PP_01255; iron ABC transporter permease	Show
1245	1309051..1309806	PP_01256; ABC transporter ATP-binding protein	Show
1246	1309826..1310836	PP_01257; ABC transporter substrate-binding protein	Show
1247	1310817..1311509	PP_01258; alpha/beta hydrolase	Show
1248	1311552..1312301	PP_01259; 1-acyl-sn-glycerol-3-phosphate acyltransferase	Show
1249	1312434..1314770	PP_01260; cation-translocating P-type ATPase	Show
1250	1314872..1315543	PP_01261; tRNA (adenine(22)-N(1))-methyltransferase TrmK	Show
1251	1315537..1316334	PP_01262; Nif3-like dinuclear metal center hexameric protein	Show
1252	1316351..1317454	PP_01263; FAD-binding oxidoreductase	Show
1253	1317461..1317775	PP_01264; hypothetical protein	Show
1254	1317754..1318773	PP_01265; UDP-glucose 4-epimerase GalE	Show
1255	1318757..1319740	PP_01266; glycosyltransferase family 2 protein	Show
1256	1319823..1320026	PP_01267; ferredoxin	Show
1257	1320072..1320578	PP_01268; LysM peptidoglycan-binding domain-containing protein	Show
1258	1320588..1321262	PP_01269; (d)CMP kinase	Show
1259	1321381..1321887	PP_01270; dihydrofolate reductase	Show
1260	1322089..1323321	PP_01271; ATP-dependent Clp protease ATP-binding subunit ClpX	Show
1261	1323330..1323917	PP_01272; ribosome biogenesis GTP-binding protein YihA/YsxC	Show
1262	1323927..1324307	PP_01273; RidA family protein	Show
1263	1324359..1325249	PP_01274; RNase adapter RapZ	Show
1264	1325246..1326223	PP_01275; YvcK family protein	Show
1265	1326220..1327131	PP_01276; DNA-binding protein WhiA	Show
1266	1327172..1328140	PP_01277; NAD(P)/FAD-dependent oxidoreductase	Show
1267	1328277..1329134	PP_01278; diadenylate cyclase CdaA	Show
1268	1329121..1329903	PP_01279; hypothetical protein	Show
1269	1329932..1331284	PP_01280; phosphoglucosamine mutase	Show
1270	1331358..1331732	PP_01281; DUF1149 family protein	Show
1271	1331735..1332583	PP_01282; DegV family protein	Show
1272	1332735..1333502	PP_01283; 4-hydroxy-tetrahydrodipicolinate reductase	Show
1273	1333499..1334698	PP_01284; CCA tRNA nucleotidyltransferase	Show
1274	1334695..1336563	PP_01285; ABC-F family ATP-binding cassette domain-containing protein	Show
1275	1336563..1337177	PP_01286; hypothetical protein	Show
1276	1337231..1338424	PP_01287; CDF family manganese efflux transporter MntE	Show
1277	1338731..1341427	PP_01288; cation-translocating P-type ATPase	Show
1278	1341532..1341942	PP_01289; peptide deformylase	Show
1279	1341954..1343549	PP_01290; hypothetical protein	Show
1280	1343605..1343766	PP_01291; DUF3953 domain-containing protein	Show
1281	1343846..1344574	PP_01292; peroxide stress protein YaaA	Show
1282	1344606..1345154	PP_01293; NAD(P)H-dependent oxidoreductase	Show
1283	1345246..1345692	PP_01294; MarR family transcriptional regulator	Show
1284	1345811..1346287	PP_01295; DUF5590 domain-containing protein	Show
1285	1346297..1347475	PP_01296; pyridoxal phosphate-dependent aminotransferase	Show
1286	1347625..1348971	PP_01297; asparagine--tRNA ligase	Show
1287	1349097..1350302	PP_01298; MFS transporter	Show
1288	1350438..1350728	PP_01299; 30S ribosomal protein S6	Show
1289	1350740..1351210	PP_01300; single-stranded DNA-binding protein	Show
1290	1351242..1351481	PP_01301; 30S ribosomal protein S18	Show
1291	1351711..1352220	PP_01302; GNAT family N-acetyltransferase	Show
1292	1352657..1353811	PP_01303; UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	Show
1293	1354733..1356043	PP_01305; glycosyltransferase	Show
1294	1356052..1357155	PP_01306; endoglucanase	Show
1295	1357278..1358678	PP_01307; bifunctional Cof-type HAD-IIB family hydrolase/peptidylprolyl isomerase	Show
1296	1358680..1359039	PP_01308; S1 RNA-binding domain-containing protein	Show
1297	1359093..1359842	PP_01309; tRNA1(Val) (adenine(37)-N6)-methyltransferase	Show
1298	1359832..1360116	PP_01310; GIY-YIG nuclease family protein	Show
1299	1360202..1361137	PP_01311; manganese-dependent inorganic pyrophosphatase	Show
1300	1361191..1361517	PP_01312; DUF2568 domain-containing protein	Show
1301	1361625..1362137	PP_01313; UDP-N-acetylmuramoylalanyl-D-glutamate--2, 6-diaminopimelate ligase	Show
1302	1362121..1362771	PP_01314; DUF1803 domain-containing protein	Show
1303	1362873..1363073	PP_01315; CsbD family protein	Show
1304	1363104..1364549	PP_01316; UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--L- lysine ligase	Show
1305	1364655..1366277	PP_01317; polysaccharide biosynthesis protein	Show
1306	1366479..1368437	PP_01318; peptide ABC transporter substrate-binding protein	Show
1307	1368583..1369677	PP_01319; cystathionine gamma-synthase	Show
1308	1369685..1370851	PP_01320; pyridoxal phosphate-dependent aminotransferase	Show
1309	1370943..1374038	PP_01321; DEAD/DEAH box helicase	Show
1310	1374086..1374697	PP_01322; cystathionine gamma-synthase	Show
1311	1374709..1376043	PP_01323; UDP-N-acetylmuramate--L-alanine ligase	Show
1312	1376053..1376520	PP_01324; GNAT family N-acetyltransferase	Show
1313	1376517..1377005	PP_01325; GNAT family N-acetyltransferase	Show
1314	1377096..1378871	PP_01326; endolytic transglycosylase MltG	Show
1315	1378934..1379416	PP_01327; transcription elongation factor GreA	Show
1316	1379493..1380857	PP_01328; amino acid permease	Show
1317	1380957..1381367	PP_01329; GNAT family N-acetyltransferase	Show
1318	1381566..1381775	PP_01330; helix-turn-helix transcriptional regulator	Show
1319	1381765..1382253	PP_01331; hypothetical protein	Show
1320	1382370..1383830	PP_01332; nicotinate phosphoribosyltransferase	Show
1321	1383827..1384651	PP_01333; ammonia-dependent NAD(+) synthetase	Show
1322	1385053..1385604	PP_01334; GNAT family N-acetyltransferase	Show
1323	1385768..1386478	PP_01335; thiol-disulfide oxidoreductase-associated membrane protein CcdA2	Show
1324	1386492..1387055	PP_01336; redoxin family protein	Show
1325	1387065..1388177	PP_01337; peptide-methionine (R)-S-oxide reductase MsrB	Show
1326	1388248..1388985	PP_01338; response regulator transcription factor	Show
1327	1388982..1390673	PP_01339; sensor histidine kinase	Show
1328	1390783..1391346	PP_01340; TIGR01440 family protein	Show
1329	1391349..1397282	PP_01341; G5 domain-containing protein	Show
1330	1397357..1399078	PP_01342; aminodeoxychorismate synthase component I	Show
1331	1399183..1399983	PP_01343; excalibur calcium-binding domain-containing protein	Show
1332	1400095..1401054	PP_01344; ROK family glucokinase	Show
1333	1401153..1401992	PP_01345; thymidylate synthase	Show
1334	1402034..1402204	PP_01346; DUF3042 family protein	Show
1335	1402325..1403209	PP_01347; tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	Show
1336	1403202..1404440	PP_01348; GTPase HflX	Show
1337	1404433..1405056	PP_01349; cystathionine beta-lyase	Show
1338	1405071..1406000	PP_01350; ribonuclease Z	Show
1339	1406021..1406776	PP_01351; SDR family oxidoreductase	Show
1340	1406979..1407548	PP_01352; SMI1/KNR4 family protein	Show
1341	1407567..1408004	PP_01353; hypothetical protein	Show
1342	1408007..1409071	PP_01354; ankyrin repeat domain-containing protein	Show
1343	1409116..1409703	PP_01355; SMI1/KNR4 family protein	Show
1344	1409700..1410449	PP_01356; hypothetical protein	Show
1345	1410468..1411424	PP_01357; hypothetical protein	Show
1346	1411576..1411905	PP_01358; hypothetical protein	Show
1347	1411912..1412106	PP_01359; helix-turn-helix transcriptional regulator	Show
1348	1412346..1414094	PP_01360; glycoside hydrolase family 13 protein	Show
1349	1414109..1414666	PP_01361; SMI1/KNR4 family protein	Show
1350	1415070..1422308	PP_01362; Ig-like domain-containing protein	Show
1351	1422487..1422849	PP_01363; DUF3397 domain-containing protein	Show
1352	1422941..1423879	PP_01364; TIGR01212 family radical SAM protein	Show
1353	1423881..1424438	PP_01365; class I SAM-dependent methyltransferase	Show
1354	1424431..1424685	PP_01366; hypothetical protein	Show
1355	1424697..1426751	PP_01367; sodium:proton antiporter	Show
1356	1426781..1427641	PP_01368; YihY/virulence factor BrkB family protein	Show
1357	1427681..1428709	PP_01369; tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	Show
1358	1428860..1429567	PP_01370; glucosamine-6-phosphate deaminase	Show
1359	1429671..1430288	PP_01371; class I SAM-dependent methyltransferase	Show
1360	1430301..1430921	PP_01372; Type 1 glutamine amidotransferase-like domain-containing protein	Show
1361	1431039..1431596	PP_01373; hypothetical protein	Show
1362	1431666..1431866	PP_01374; 30S ribosomal protein S21	Show
1363	1432803..1433738	PP_01376; HPr(Ser) kinase/phosphatase	Show
1364	1433731..1434519	PP_01377; prolipoprotein diacylglyceryl transferase	Show
1365	1434520..1434903	PP_01378; DUF948 domain-containing protein	Show
1366	1434919..1435317	PP_01379; YtxH domain-containing protein	Show
1367	1435391..1436521	PP_01380; radical SAM family heme chaperone HemW	Show
1368	1436526..1437263	PP_01381; acyl-[acyl-carrier-protein] thioesterase	Show
1369	1437274..1438047	PP_01382; TIGR01457 family HAD-type hydrolase	Show
1370	1438037..1438654	PP_01383; TIGR01906 family membrane protein	Show
1371	1438875..1439276	PP_01384; Spx/MgsR family RNA polymerase-binding regulatory protein	Show
1372	1439277..1439555	PP_01385; UPF0223 family protein	Show
1373	1439545..1440318	PP_01386; inositol monophosphatase family protein	Show
1374	1440319..1441623	PP_01387; RsmF rRNA methyltransferase first C-terminal domain-containing protein	Show
1375	1441832..1442710	PP_01388; phosphate ABC transporter substrate-binding protein PstS	Show
1376	1442710..1443627	PP_01389; phosphate ABC transporter permease subunit PstC	Show
1377	1443617..1444501	PP_01390; phosphate ABC transporter permease PstA	Show
1378	1444512..1445315	PP_01391; phosphate ABC transporter ATP-binding protein PstB	Show
1379	1445328..1446086	PP_01392; phosphate ABC transporter ATP-binding protein PstB	Show
1380	1446098..1446751	PP_01393; phosphate signaling complex protein PhoU	Show
1381	1446908..1447723	PP_01394; ABC transporter substrate-binding protein	Show
1382	1447743..1449014	PP_01395; PLP-dependent aminotransferase family protein	Show
1383	1449160..1449891	PP_01396; acetolactate decarboxylase	Show
1384	1449901..1450653	PP_01397; YhfC family intramembrane metalloprotease	Show
1385	1450765..1451670	PP_01398; UDP-N-acetylmuramate dehydrogenase	Show
1386	1451829..1452986	PP_01399; ABC transporter ATP-binding protein	Show
1387	1452967..1453773	PP_01400; ABC transporter permease	Show
1388	1453770..1454543	PP_01401; ABC transporter permease	Show
1389	1454540..1455610	PP_01402; ABC transporter substrate-binding protein	Show
1390	1455797..1456162	PP_01403; DUF3021 domain-containing protein	Show
1391	1456405..1456890	PP_01404; LURP-one-related family protein	Show
1392	1456911..1459529	PP_01405; alanine--tRNA ligase	Show
1393	1459619..1461073	PP_01406; alpha-amylase	Show
1394	1461346..1462509	PP_01407; class I SAM-dependent rRNA methyltransferase	Show
1395	1462506..1463183	PP_01408; type I 3-dehydroquinate dehydratase	Show
1396	1463173..1464027	PP_01409; shikimate dehydrogenase	Show
1397	1464046..1465113	PP_01410; 3-dehydroquinate synthase	Show
1398	1465123..1466289	PP_01411; chorismate synthase	Show
1399	1466299..1466582	PP_01412; prephenate dehydrogenase/arogenate dehydrogenase family protein	Show
1400	1466584..1466657	tRNA-Asn	Show
1401	1466867..1467100	PP_01413; sigma(X)-activator ComW	Show
1402	1467345..1468631	PP_01414; adenylosuccinate synthase	Show
1403	1468832..1469299	PP_01415; tRNA adenosine(34) deaminase TadA	Show
1404	1469485..1469928	PP_01416; dUTP diphosphatase	Show
1405	1469938..1470405	PP_01417; cysteine hydrolase	Show
1406	1470402..1471763	PP_01418; DNA repair protein RadA	Show
1407	1471836..1472330	PP_01419; carbonic anhydrase	Show
1408	1472544..1473512	PP_01420; ribose-phosphate diphosphokinase	Show
1409	1473631..1474068	PP_01421; CoA-binding protein	Show
1410	1474097..1475107	PP_01422; YeiH family protein	Show
1411	1475256..1476425	PP_01423; pyridoxal phosphate-dependent aminotransferase	Show
1412	1476422..1477192	PP_01424; DNA repair protein RecO	Show
1413	1477189..1478181	PP_01425; phosphate acyltransferase PlsX	Show
1414	1478187..1478423	PP_01426; acyl carrier protein	Show
1415	1478859..1479047	PP_01427; class IIb bacteriocin, lactobin A/cerein 7B family	Show
1416	1479065..1479232	PP_01428; bacteriocin	Show
1417	1479242..1479430	PP_01429; hypothetical protein	Show
1418	1480025..1482178	PP_01430; peptide cleavage/export ABC transporter ComA	Show
1419	1482191..1483540	PP_01431; competence pheromone export protein ComB	Show
1420	1483709..1484416	PP_01432; phosphoribosylaminoimidazolesuccinocarboxamide synthase	Show
1421	1484484..1488209	PP_01433; phosphoribosylformylglycinamidine synthase	Show
1422	1488303..1489745	PP_01434; amidophosphoribosyltransferase	Show
1423	1489966..1490988	PP_01435; phosphoribosylformylglycinamidine cyclo-ligase	Show
1424	1490985..1491530	PP_01436; phosphoribosylglycinamide formyltransferase	Show
1425	1491546..1493093	PP_01437; bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	Show
1426	1493104..1493763	PP_01438; hypothetical protein	Show
1427	1493954..1495219	PP_01439; phosphoribosylamine--glycine ligase	Show
1428	1495626..1496114	PP_01440; 5-(carboxyamino)imidazole ribonucleotide mutase	Show
1429	1496101..1497192	PP_01441; 5-(carboxyamino)imidazole ribonucleotide synthase	Show
1430	1497193..1498143	PP_01442; NAD(P)-binding domain-containing protein	Show
1431	1498207..1498377	PP_01443; phosphoribosylaminoimidazole carboxylase	Show
1432	1498393..1499430	PP_01444; hypothetical protein	Show
1433	1499423..1499566	PP_01445; hypothetical protein	Show
1434	1499648..1500259	PP_01446; hypothetical protein	Show
1435	1500472..1501770	PP_01447; adenylosuccinate lyase	Show
1436	1501828..1505859	PP_01448; family 20 glycosylhydrolase	Show
1437	1506154..1506870	PP_01449; GntR family transcriptional regulator	Show
1438	1507191..1508978	PP_01450; beta-galactosidase	Show
1439	1508975..1509451	PP_01451; PTS system mannose/fructose/N-acetylgalactosamine-transporter subunit IIB	Show
1440	1509478..1510383	PP_01452; PTS mannose/fructose/sorbose/N-acetylgalactosamine transporter subunit IIC	Show
1441	1510370..1511191	PP_01453; PTS system mannose/fructose/sorbose family transporter subunit IID	Show
1442	1511195..1511599	PP_01454; PTS sugar transporter subunit IIA	Show
1443	1511869..1513035	PP_01455; SIS domain-containing protein	Show
1444	1513046..1514041	PP_01456; tagatose-bisphosphate aldolase	Show
1445	1514187..1515224	PP_01457; galactose mutarotase	Show
1446	1515335..1516189	PP_01458; VOC family protein	Show
1447	1516303..1517535	PP_01459; HAMP domain-containing histidine kinase	Show
1448	1517536..1518210	PP_01460; response regulator transcription factor	Show
1449	1518220..1518840	PP_01461; GTP pyrophosphokinase family protein	Show
1450	1518988..1519245	PP_01462; metal-sensitive transcriptional regulator	Show
1451	1519551..1519847	PP_01463; rhodanese-like domain-containing protein	Show
1452	1519837..1521492	PP_01464; FAD-dependent oxidoreductase	Show
1453	1521513..1521818	PP_01465; rhodanese-like domain-containing protein	Show
1454	1521994..1522557	PP_01466; sugar O-acetyltransferase	Show
1455	1522830..1524065	PP_01467; carbohydrate-binding domain-containing protein	Show
1456	1524286..1524753	PP_01468; hypothetical protein	Show
1457	1525174..1525890	PP_01469; ABC transporter ATP-binding protein	Show
1458	1525892..1526974	PP_01470; ABC transporter permease	Show
1459	1527014..1527637	PP_01471; TetR/AcrR family transcriptional regulator	Show
1460	1527922..1528686	PP_01472; nucleoside phosphorylase	Show
1461	1528720..1530099	PP_01473; TrkH family potassium uptake protein	Show
1462	1530113..1530778	PP_01474; TrkA family potassium uptake protein	Show
1463	1530935..1533469	PP_01475; fibronectin-binding SSURE repeat-containing protein	Show
1464	1533550..1534248	PP_01476; response regulator transcription factor	Show
1465	1534245..1535279	PP_01477; HAMP domain-containing protein	Show
1466	1535482..1536093	PP_01478; 30S ribosomal protein S4	Show
1467	1549930..1550448	PP_01500; HXXEE domain-containing protein	Show
1468	1550527..1550676	PP_01501; 50S ribosomal protein L33	Show
1469	1550692..1550874	PP_01502; 50S ribosomal protein L32	Show
1470	1551095..1552798	PP_01503; dihydroxy-acid dehydratase	Show
1471	1552964..1553305	PP_01504; metal-sulfur cluster assembly factor	Show
1472	1553473..1554753	PP_01505; histidine--tRNA ligase	Show
1473	1554897..1555100	PP_01506; helix-turn-helix transcriptional regulator	Show
1474	1555300..1555650	PP_01508; PspC domain-containing protein	Show
1475	1555664..1556398	PP_01509; DUF3169 family protein	Show
1476	1556410..1557051	PP_01510; CPBP family intramembrane metalloprotease	Show
1477	1557069..1557287	PP_01511; hypothetical protein	Show
1478	1557439..1559202	PP_01512; aspartate--tRNA ligase	Show
1479	1559180..1560121	PP_01513; YitT family protein	Show
1480	1561506..1562102	PP_01516; YdhK family protein	Show
1481	1562513..1562707	PP_01519; CsbD family protein	Show
1482	1562748..1564859	PP_01520; cadmium-translocating P-type ATPase	Show
1483	1564879..1565328	PP_01521; CopY/TcrY family copper transport repressor	Show
1484	1565841..1566035	PP_01522; hypothetical protein	Show
1485	1566016..1566348	PP_01523; hypothetical protein	Show
1486	1566708..1567547	PP_01524; phage replisome organizer N-terminal domain-containing protein;phage replisome organizer N-terminal domain-containing protein	Show
1487	1567556..1567837	PP_01525; DNA-binding protein	Show
1488	1567985..1568503	PP_01526; helix-turn-helix domain-containing protein	Show
1489	1568555..1569709	PP_01527; site-specific integrase	Show
1490	1569841..1570233	PP_01528; 30S ribosomal protein S9	Show
1491	1570252..1570698	PP_01529; 50S ribosomal protein L13	Show
1492	1570913..1572112	PP_01530; ABC transporter permease	Show
1493	1572109..1573002	PP_01531; ABC transporter ATP-binding protein	Show
1494	1573253..1575658	PP_01532; phenylalanine--tRNA ligase subunit beta	Show
1495	1575788..1576834	PP_01533; phenylalanine--tRNA ligase subunit alpha	Show
1496	1577592..1578242	PP_01535; phosphatase PAP2 family protein	Show
1497	1578232..1578795	PP_01536; ECF transporter S component	Show
1498	1579208..1579711	PP_01537; tRNA (cytidine(34)-2'-O)-methyltransferase	Show
1499	1580112..1581461	PP_01538; Trk system potassium transporter TrkA	Show
1500	1581465..1582904	PP_01539; TrkH family potassium uptake protein	Show
1501	1582994..1583923	PP_01540; ATP-binding cassette domain-containing protein	Show
1502	1583934..1585001	PP_01541; ABC transporter ATP-binding protein	Show
1503	1585010..1585936	PP_01542; ABC transporter permease	Show
1504	1585936..1587432	PP_01543; ABC transporter permease	Show
1505	1587499..1589478	PP_01544; peptide ABC transporter substrate-binding protein	Show
1506	1589777..1589847	tRNA-Cys	Show
1507	1589981..1591312	PP_01545; hemolysin family protein	Show
1508	1591444..1592268	PP_01546; DNA/RNA non-specific endonuclease	Show
1509	1592309..1592503	PP_01547; DNA-directed RNA polymerase subunit beta	Show
1510	1592490..1593773	PP_01548; UDP-N-acetylglucosamine 1-carboxyvinyltransferase	Show
1511	1593797..1594027	PP_01549; DUF1146 family protein	Show
1512	1594083..1595120	PP_01550; PDZ domain-containing protein	Show
1513	1595104..1595592	PP_01551; pantetheine-phosphate adenylyltransferase	Show
1514	1595582..1596121	PP_01552; 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	Show
1515	1596186..1597178	PP_01553; aspartate--ammonia ligase	Show
1516	1597288..1597971	PP_01554; Bax inhibitor-1/YccA family protein	Show
1517	1598027..1598767	PP_01555; RNA methyltransferase	Show
1518	1598801..1599079	PP_01556; acylphosphatase	Show
1519	1599157..1600086	PP_01557; membrane protein insertase YidC	Show
1520	1600160..1600954	PP_01558; pyruvate formate lyase-activating protein	Show
1521	1601076..1602332	PP_01559; diaminopimelate decarboxylase	Show
1522	1602399..1603226	PP_01560; pur operon repressor	Show
1523	1603331..1604272	PP_01561; 3'-5' exoribonuclease YhaM family protein	Show
1524	1604262..1605518	PP_01562; DNA recombination protein RmuC	Show
1525	1605520..1606182	PP_01563; thiamine diphosphokinase	Show
1526	1606145..1606801	PP_01564; ribulose-phosphate 3-epimerase	Show
1527	1606812..1607690	PP_01565; ribosome small subunit-dependent GTPase A	Show
1528	1607692..1608564	PP_01566; 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	Show
1529	1608584..1609297	PP_01567; dimethyladenosine transferase	Show
1530	1609489..1609824	PP_01568; hypothetical protein	Show
1531	1610018..1610872	PP_01569; SDR family NAD(P)-dependent oxidoreductase	Show
1532	1610884..1611447	PP_01570; ribonuclease M5	Show
1533	1611447..1612220	PP_01571; TatD family hydrolase	Show
1534	1612370..1614214	PP_01572; APC family permease	Show
1535	1614396..1614530	PP_01573; 50S ribosomal protein L34	Show
1536	1614675..1615889	PP_01574; pyridoxal phosphate-dependent aminotransferase	Show
1537	1616136..1616588	PP_01575; universal stress protein	Show
1538	1616712..1618643	PP_01576; CAP domain-containing protein	Show
1539	1619161..1620555	PP_01577; Cof-type HAD-IIB family hydrolase	Show
1540	1620621..1621583	PP_01578; asparaginase	Show
1541	1621636..1622646	PP_01579; catabolite control protein A	Show
1542	1622851..1623168	PP_01580; DUF960 domain-containing protein	Show
1543	1623219..1624502	PP_01581; DUF308 domain-containing protein	Show
1544	1624495..1625316	PP_01582; 2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	Show
1545	1625476..1626030	PP_01583; GTP cyclohydrolase I FolE	Show
1546	1626034..1627335	PP_01584; bifunctional folylpolyglutamate synthase/dihydrofolate synthase	Show
1547	1627337..1628311	PP_01585; dihydropteroate synthase	Show
1548	1628387..1629094	PP_01586; CPBP family intramembrane metalloprotease	Show
1549	1629149..1630567	PP_01587; NCS2 family permease	Show
1550	1630754..1631566	PP_01588; Cof-type HAD-IIB family hydrolase	Show
1551	1631847..1632836	PP_01589; PTS sugar transporter subunit IIB	Show
1552	1632911..1633723	PP_01590; PTS mannose/fructose/sorbose transporter subunit IIC	Show
1553	1633738..1634649	PP_01591; PTS system mannose/fructose/sorbose family transporter subunit IID	Show
1554	1634712..1636940	PP_01592; HAD-IC family P-type ATPase	Show
1555	1637106..1638440	PP_01593; aminopeptidase C	Show
1556	1638550..1639272	PP_01594; rRNA pseudouridine synthase	Show
1557	1639505..1639735	PP_01595; GlsB/YeaQ/YmgE family stress response membrane protein	Show
1558	1639745..1640986	PP_01596; aminopeptidase	Show
1559	1641002..1641154	PP_01597; hypothetical protein	Show
1560	1641228..1643108	PP_01598; DUF262 domain-containing HNH endonuclease family protein	Show
1561	1643102..1644415	PP_01599; DUF262 domain-containing protein	Show
1562	1644423..1645373	PP_01600; WYL domain-containing protein	Show
1563	1646094..1650485	PP_01602; PolC-type DNA polymerase III	Show
1564	1650660..1650736	tRNA-Pro	Show
1565	1650737..1653643	PP_01603; isopeptide-forming domain-containing fimbrial protein	Show
1566	1653705..1654292	PP_01604; TlpA family protein disulfide reductase	Show
1567	1654670..1656016	PP_01605; type I glutamate--ammonia ligase	Show
1568	1656055..1656411	PP_01606; transcriptional repressor GlnR	Show
1569	1656488..1657015	PP_01607; FUSC family protein	Show
1570	1657149..1661663	PP_01608; antigen I/II family LPXTG-anchored adhesin	Show
1571	1661828..1663027	PP_01609; phosphoglycerate kinase	Show
1572	1663311..1668293	PP_01610; bacterial Ig-like domain-containing protein	Show
1573	1668627..1670258	PP_01611; Na/Pi cotransporter family protein	Show
1574	1670353..1670649	PP_01612; bacteriocin immunity protein	Show
1575	1670672..1671736	PP_01613; glutamyl aminopeptidase	Show
1576	1671973..1672932	PP_01614; ABC transporter permease	Show
1577	1672922..1673878	PP_01615; iron chelate uptake ABC transporter family permease subunit	Show
1578	1673875..1674627	PP_01616; ATP-binding cassette domain-containing protein	Show
1579	1674725..1675696	PP_01617; siderophore ABC transporter substrate-binding protein	Show
1580	1675728..1675970	PP_01618; membrane protein insertion efficiency factor YidD	Show
1581	1675970..1676692	PP_01619; rRNA pseudouridine synthase	Show
1582	1676679..1677248	PP_01620; segregation/condensation protein B	Show
1583	1677267..1677995	PP_01621; segregation/condensation protein A	Show
1584	1677995..1678735	PP_01622; site-specific tyrosine recombinase XerD	Show
1585	1678726..1679187	PP_01623; CBS domain-containing protein	Show
1586	1679184..1679705	PP_01624; metallophosphoesterase	Show
1587	1679681..1680652	PP_01625; nucleoside-triphosphate diphosphatase	Show
1588	1680649..1681443	PP_01626; glutamate racemase	Show
1589	1681649..1681897	PP_01627; YneF family protein	Show
1590	1682042..1683667	PP_01628; alpha,alpha-phosphotrehalase	Show
1591	1683731..1685698	PP_01629; PTS system trehalose-specific EIIBC component	Show
1592	1685883..1686596	PP_01630; trehalose operon repressor	Show
1593	1686850..1692033	PP_01631; glycoside hydrolase N-terminal domain-containing protein	Show
1594	1692102..1693082	PP_01632; phospho-N-acetylmuramoyl-pentapeptide- transferase	Show
1595	1693084..1695339	PP_01633; penicillin-binding protein PBP2X	Show
1596	1695343..1695660	PP_01634; cell division protein FtsL	Show
1597	1695671..1696621	PP_01635; 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH	Show
1598	1696784..1696978	PP_01636; helix-turn-helix transcriptional regulator	Show
1599	1696994..1697536	PP_01637; DUF3278 domain-containing protein	Show
1600	1697547..1697888	PP_01638; hypothetical protein	Show
1601	1697901..1698479	PP_01639; DUF3278 domain-containing protein	Show
1602	1698476..1698952	PP_01640; glutathione peroxidase	Show
1603	1699294..1705020	PP_01641; alpha-L-fucosidase	Show
1604	1705384..1705677	PP_01642; hypothetical protein	Show
1605	1705670..1706032	PP_01643; hypothetical protein	Show
1606	1706029..1707444	PP_01644; Y-family DNA polymerase	Show
1607	1707448..1708134	PP_01645; XRE family transcriptional regulator	Show
1608	1708398..1708910	PP_01646; GNAT family N-acetyltransferase	Show
1609	1709660..1710436	PP_01648; zeta toxin family protein	Show
1610	1710436..1710912	PP_01649; helix-turn-helix domain-containing protein	Show
1611	1711305..1712909	PP_01650; ABC transporter ATP-binding protein/permease	Show
1612	1712902..1713168	PP_01651; metalloregulator ArsR/SmtB family transcription factor	Show
1613	1713165..1713968	PP_01652; hypothetical protein	Show
1614	1717185..1718843	PP_01655; mercury(II) reductase	Show
1615	1718872..1719264	PP_01656; Hg(II)-responsive transcriptional regulator	Show
1616	1719534..1719872	PP_01657; Cd(II)/Zn(II)-sensing metalloregulatory transcriptional regulator CadX	Show
1617	1719884..1720510	PP_01658; CadD family cadmium resistance transporter	Show
1618	1721297..1722037	PP_01659; G5 domain-containing protein	Show
1619	1722195..1722515	PP_01660; PadR family transcriptional regulator	Show
1620	1722515..1723090	PP_01661; DUF2812 domain-containing protein	Show
1621	1723125..1723634	PP_01662; DUF2812 domain-containing protein	Show
1622	1723798..1724832	PP_01663; heat-inducible transcriptional repressor HrcA	Show
1623	1724859..1725374	PP_01664; nucleotide exchange factor GrpE	Show
1624	1725750..1727573	PP_01665; molecular chaperone DnaK	Show
1625	1728016..1729152	PP_01666; molecular chaperone DnaJ	Show
1626	1729232..1729885	PP_01667; hypothetical protein	Show
1627	1729955..1730233	PP_01668; hypothetical protein	Show
1628	1730243..1730653	PP_01669; HIT family protein	Show
1629	1730721..1731452	PP_01670; ABC transporter ATP-binding protein	Show
1630	1731449..1732498	PP_01671; ABC transporter permease	Show
1631	1732546..1733340	PP_01672; phosphotransferase family protein	Show
1632	1733337..1733972	PP_01673; tRNA (guanosine(46)-N7)-methyltransferase TrmB	Show
1633	1734099..1734578	PP_01674; ribosome maturation factor RimP	Show
1634	1734621..1735757	PP_01675; transcription termination factor NusA	Show
1635	1735779..1736072	PP_01676; YlxR family protein	Show
1636	1736065..1736364	PP_01677; YlxQ-related RNA-binding protein	Show
1637	1736381..1739167	PP_01678; translation initiation factor IF-2	Show
1638	1739334..1739684	PP_01679; 30S ribosome-binding factor RbfA	Show
1639	1739836..1740615	PP_01680; hypothetical protein	Show
1640	1740617..1740799	PP_01681; hypothetical protein	Show
1641	1741060..1741293	PP_01682; DUF1858 domain-containing protein	Show
1642	1741293..1742627	PP_01683; DUF438 domain-containing protein	Show
1643	1742637..1742891	PP_01684; DUF1912 family protein	Show
1644	1742989..1743384	PP_01685; helicase	Show
1645	1743664..1744230	PP_01686; GNAT family N-acetyltransferase	Show
1646	1744223..1745923	PP_01687; hypothetical protein	Show
1647	1745944..1748595	PP_01688; valine--tRNA ligase	Show
1648	1748709..1749689	PP_01689; FRG domain-containing protein	Show
1649	1749682..1751832	PP_01690; hypothetical protein	Show
1650	1752094..1753755	PP_01691; DNA (cytosine-5-)-methyltransferase	Show
1651	1753773..1755023	PP_01692; chromosome partitioning protein ParB	Show
1652	1755041..1757707	PP_01693; DEAD/DEAH box helicase family protein	Show
1653	1757925..1758515	PP_01694; DNA-directed RNA polymerase subunit delta	Show
1654	1758845..1760452	PP_01695; CTP synthase	Show
1655	1760629..1760928	PP_01696; DUF4651 domain-containing protein	Show
1656	1760925..1761242	PP_01697; thioredoxin family protein	Show
1657	1761258..1761884	PP_01698; DUF4479 and tRNA-binding domain-containing protein	Show
1658	1761926..1762687	PP_01699; SDR family NAD(P)-dependent oxidoreductase	Show
1659	1762765..1763160	PP_01700; single-stranded DNA-binding protein	Show
1660	1763317..1763601	PP_01701; co-chaperone GroES	Show
1661	1763617..1765239	PP_01702; chaperonin GroEL	Show
1662	1765379..1766146	PP_01703; epoxyqueuosine reductase QueH	Show
1663	1766217..1766750	PP_01704; DUF402 domain-containing protein	Show
1664	1766839..1767615	PP_01705; recombination regulator RecX	Show
1665	1767653..1769014	PP_01706; 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	Show
1666	1769209..1769682	PP_01707; sigma-70 family RNA polymerase sigma factor	Show
1667	1769803..1770339	PP_01708; transcription termination/antitermination protein NusG	Show
1668	1770391..1770567	PP_01709; preprotein translocase subunit SecE	Show
1669	1770577..1770729	PP_01710; 50S ribosomal protein L33	Show
1670	1770782..1772977	PP_01711; penicillin-binding protein PBP2A	Show
1671	1773103..1773939	PP_01712; RluA family pseudouridine synthase	Show
1672	1774010..1775017	PP_01713; type I glyceraldehyde-3-phosphate dehydrogenase	Show
1673	1775334..1777985	PP_01714; bifunctional acetaldehyde-CoA/alcohol dehydrogenase	Show
1674	1778281..1778694	PP_01715; hypothetical protein	Show
1675	1778681..1779124	PP_01716; low molecular weight phosphotyrosine protein phosphatase	Show
1676	1779172..1779492	PP_01717; preprotein translocase subunit YajC	Show
1677	1779610..1781586	PP_01718; transketolase	Show
1678	1781705..1782328	PP_01719; ribonuclease P	Show
1679	1782384..1783370	PP_01720; protein jag	Show
1680	1783385..1784212	PP_01721; membrane protein insertase YidC	Show
1681	1784187..1784558	PP_01722; ribonuclease P protein component	Show
1682	1784704..1785897	PP_01723; acetate kinase	Show
1683	1785948..1786901	PP_01724; class I SAM-dependent methyltransferase	Show
1684	1786960..1787550	PP_01725; class I SAM-dependent methyltransferase	Show
1685	1787583..1787996	PP_01726; competence protein ComGF	Show
1686	1787974..1788435	PP_01727; competence protein ComGF	Show
1687	1788398..1788700	PP_01728; hypothetical protein	Show
1688	1788663..1789097	PP_01729; type II secretion system GspH family protein	Show
1689	1789060..1789383	PP_01730; prepilin-type N-terminal cleavage/methylation domain-containing protein	Show
1690	1789385..1790401	PP_01731; type II secretion system F family protein	Show
1691	1790349..1791290	PP_01732; GspE/PulE family protein	Show
1692	1791352..1791717	PP_01733; DUF1033 family protein	Show
1693	1791875..1793026	PP_01734; N-acetylglucosamine-6-phosphate deacetylase	Show
1694	1793167..1794984	PP_01735; acyltransferase	Show
1695	1795115..1796257	PP_01736; tRNA guanosine(34) transglycosylase Tgt	Show
1696	1796374..1797231	PP_01737; DUF975 family protein	Show
1697	1797272..1797634	PP_01738; DUF1304 domain-containing protein	Show
1698	1797645..1798070	PP_01739; MarR family winged helix-turn-helix transcriptional regulator	Show
1699	1798229..1799092	PP_01740; DUF2262 domain-containing protein	Show
1700	1799242..1800468	PP_01741; LysM peptidoglycan-binding domain-containing protein	Show
1701	1800634..1801254	PP_01742; HAD family hydrolase	Show
1702	1801258..1802538	PP_01743; MATE family efflux transporter	Show
1703	1802599..1804083	PP_01744; threonine synthase	Show
1704	1804159..1805436	PP_01745; gamma-glutamylcysteine synthetase	Show
1705	1806166..1806249	tRNA-Leu	Show
1706	1806259..1806330	tRNA-Gln	Show
1707	1806344..1806416	tRNA-His	Show
1708	1806431..1806501	tRNA-Trp	Show
1709	1806513..1806593	tRNA-Tyr	Show
1710	1806611..1806683	tRNA-Phe	Show
1711	1806688..1806761	tRNA-Met	Show
1712	1806772..1806861	tRNA-Ser	Show
1713	1806868..1806939	tRNA-Glu	Show
1714	1806951..1807024	tRNA-Ile	Show
1715	1807677..1808357	PP_01747; rhomboid family intramembrane serine protease	Show
1716	1808341..1808880	PP_01748; 5-formyltetrahydrofolate cyclo-ligase	Show
1717	1808892..1810022	PP_01749; N-acetyldiaminopimelate deacetylase	Show
1718	1810092..1810790	PP_01750; 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase	Show
1719	1810884..1811786	PP_01751; DMT family transporter	Show
1720	1811867..1814368	PP_01752; penicillin-binding protein PBP1B	Show
1721	1814509..1815765	PP_01753; tyrosine--tRNA ligase	Show
1722	1815843..1817906	PP_01754; heavy metal translocating P-type ATPase	Show
1723	1817908..1818186	PP_01755; hypothetical protein	Show
1724	1818338..1819186	PP_01756; methyltransferase domain-containing protein	Show
1725	1819735..1821993	PP_01757; glycogen/starch/alpha-glucan family phosphorylase	Show
1726	1822071..1823603	PP_01758; 4-alpha-glucanotransferase	Show
1727	1824079..1825347	PP_01759; extracellular solute-binding protein	Show
1728	1825472..1826764	PP_01760; ABC transporter permease subunit	Show
1729	1826766..1827608	PP_01761; sugar ABC transporter permease	Show
1730	1827868..1828668	PP_01762; DUF1189 family protein	Show
1731	1828678..1829664	PP_01763; LacI family DNA-binding transcriptional regulator	Show
1732	1829755..1829826	tRNA-Glu	Show
1733	1829943..1830377	PP_01764; cytidine deaminase	Show
1734	1830390..1831850	PP_01765; glutamate--tRNA ligase	Show
1735	1831985..1833334	PP_01766; glucose-6-phosphate isomerase	Show
1736	1833503..1834192	PP_01767; gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	Show
1737	1834331..1836097	PP_01768; ABC transporter ATP-binding protein/permease	Show
1738	1836099..1837805	PP_01769; ABC transporter ATP-binding protein/permease	Show
1739	1838012..1839028	PP_01770; NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	Show
1740	1839050..1839949	PP_01771; UTP--glucose-1-phosphate uridylyltransferase GalU	Show
1741	1840316..1844575	PP_01772; type II CRISPR RNA-guided endonuclease Cas9	Show
1742	1844575..1845441	PP_01773; type II CRISPR-associated endonuclease Cas1	Show
1743	1845438..1845782	PP_01774; CRISPR-associated endonuclease Cas2	Show
1744	1845772..1846434	PP_01775; type II-A CRISPR-associated protein Csn2	Show
1745	1847683..1848510	PP_01776; prephenate dehydrogenase	Show
1746	1848521..1848859	PP_01777; YlbF/YmcA family competence regulator	Show
1747	1848950..1850233	PP_01778; 3-phosphoshikimate 1-carboxyvinyltransferase	Show
1748	1850226..1850702	PP_01779; shikimate kinase	Show
1749	1850699..1851547	PP_01780; prephenate dehydratase	Show
1750	1851544..1852839	PP_01781; LCP family protein	Show
1751	1852985..1853821	PP_01782; phosphorylcholine transferase LicD	Show
1752	1853811..1854914	PP_01783; glycosyltransferase	Show
1753	1854916..1855902	PP_01784; glycosyltransferase	Show
1754	1855918..1857375	PP_01785; O-antigen polysaccharide polymerase Wzy family protein	Show
1755	1857379..1858416	PP_01786; prephenate dehydratase	Show
1756	1858643..1860127	PP_01787; lipopolysaccharide biosynthesis protein	Show
1757	1860140..1860943	PP_01788; LicD family protein	Show
1758	1860944..1861759	PP_01789; phosphorylcholine transferase LicD	Show
1759	1861896..1863604	PP_01790; MBL fold metallo-hydrolase	Show
1760	1864404..1864694	PP_01791; WXG100 family type VII secretion target	Show
1761	1864741..1865226	PP_01792; type VII secretion protein EssA	Show
1762	1865189..1865446	PP_01793; type VII secretion protein	Show
1763	1865456..1866655	PP_01794; type VII secretion protein EssB	Show
1764	1866656..1871089	PP_01795; type VII secretion protein EssC	Show
1765	1871273..1871668	PP_01796; DUF5082 domain-containing protein	Show
1766	1871677..1871976	PP_01797; variable surface protein mvspG	Show
1767	1871973..1872626	PP_01798; DUF4176 domain-containing protein	Show
1768	1872616..1874352	PP_01799; LXG domain-containing protein	Show
1769	1874349..1875074	PP_01800; hypothetical protein	Show
1770	1875067..1875495	PP_01801; hypothetical protein	Show
1771	1875497..1875973	PP_01802; DUF5085 family protein	Show
1772	1876247..1878934	PP_01803; type VII secretion protein EsaA	Show
1773	1878987..1879263	PP_01804; IS3 family transposase	Show
1774	1881598..1881670	tRNA-Ala	Show
1775	1882548..1884527	PP_01805; isopeptide-forming domain-containing fimbrial protein	Show
1776	1884674..1884859	PP_01806; hypothetical protein	Show
1777	1884861..1885430	PP_01807; hypothetical protein	Show
1778	1885433..1885642	PP_01808; helix-turn-helix transcriptional regulator	Show
1779	1885645..1885833	PP_01809; hypothetical protein	Show
1780	1885914..1886061	PP_01810; transposase	Show
1781	1886062..1886561	PP_01811; phage scaffolding protein;phage scaffolding protein	Show
1782	1886700..1887172	PP_01812; phage minor capsid protein;phage minor capsid protein	Show
1783	1887173..1888180	PP_01813; adhesin	Show
1784	1888181..1888626	PP_01814; phage minor capsid protein;phage minor capsid protein	Show
1785	1888641..1889012	PP_01815; hypothetical protein	Show
1786	1889215..1890027	PP_01816; hypothetical protein	Show
1787	1890028..1890317	PP_01817; minor capsid protein	Show
1788	1890307..1890699	PP_01818; hypothetical protein	Show
1789	1890891..1891720	PP_01819; isopeptide-forming domain-containing fimbrial protein	Show
1790	1891721..1892540	PP_01820; peptidase S41	Show
1791	1892541..1893337	PP_01821; phage tail family protein;phage tail family protein	Show
1792	1894059..1894766	PP_01822; isopeptide-forming domain-containing fimbrial protein	Show
1793	1894767..1895464	PP_01823; isopeptide-forming domain-containing fimbrial protein	Show
1794	1895465..1895773	PP_01824; stress-induced protein	Show
1795	1895763..1896159	PP_01825; phage terminase large subunit;phage terminase large subunit	Show
1796	1896160..1896692	PP_01826; hypothetical protein	Show
1797	1896845..1897513	PP_01827; phosphate-transport permease PitB	Show
1798	1897538..1898179	PP_01828; peptidylprolyl isomerase	Show
1799	1898183..1898849	PP_01829; isopeptide-forming domain-containing fimbrial protein	Show
1800	1898850..1899200	PP_01830; XRE family transcriptional regulator	Show
1801	1899505..1899969	PP_01831; carboxylate--amine ligase	Show
1802	1899989..1900148	PP_01832; AIR carboxylase family protein	Show
1803	1901462..1901638	PP_01835; hypothetical protein	Show
1804	1901640..1901972	PP_01836; DUF1372 family protein	Show
1805	1902003..1902604	PP_01837; LicD family protein	Show
1806	1902718..1903204	PP_01838; ERF family protein	Show
1807	1903205..1903796	PP_01839; helicase	Show
1808	1903797..1904231	PP_01840; multidrug MFS transporter	Show
1809	1904231..1904366	PP_01841; UDP-N-acetylglucosamine--LPS N-acetylglucosamine transferase	Show
1810	1904367..1904931	PP_01842; isopeptide-forming domain-containing fimbrial protein	Show
1811	1904932..1905385	PP_01843; ATP-binding cassette domain-containing protein	Show
1812	1905495..1905829	PP_01844; hypothetical protein	Show
1813	1905870..1906053	PP_01845; replication initiation protein	Show
1814	1907274..1907716	PP_01847; phosphoribosyl-ATP diphosphatase	Show
1815	1907717..1908267	PP_01848; bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	Show
1816	1908814..1909353	PP_01850; adhesin	Show
1817	1909354..1909881	PP_01851; O-antigen ligase family protein	Show
1818	1909892..1910428	PP_01852; phage portal protein;phage portal protein	Show
1819	1910429..1910964	PP_01853; AraC family ligand binding domain-containing protein	Show
1820	1910965..1911116	PP_01854; DUF1351 domain-containing protein	Show
1821	1911129..1911455	PP_01855; hypothetical protein	Show
1822	1912021..1912546	PP_01857; DNA cytosine methyltransferase	Show
1823	1912547..1913070	PP_01858; hypothetical protein	Show
1824	1913071..1913579	PP_01859; peptide ABC transporter ATP-binding protein	Show
1825	1913595..1914114	PP_01860; hypothetical protein	Show
1826	1914160..1914632	PP_01861; DUF389 domain-containing protein	Show
1827	1914633..1915147	PP_01862; hypothetical protein	Show
1828	1915315..1915662	PP_01863; hypothetical protein	Show
1829	1915663..1916175	PP_01864; hypothetical protein	Show
1830	1916176..1916345	PP_01865; diacylglycerol kinase family lipid kinase	Show
1831	1916511..1916687	PP_01866; 23S rRNA (uracil-5-)-methyltransferase RumA	Show
1832	1916679..1916749	tRNA-Gly	Show
1833	1916777..1916849	tRNA-Thr	Show
1834	1916862..1916943	tRNA-Leu	Show
1835	1916949..1917021	tRNA-Lys	Show
1836	1917046..1917118	tRNA-Asp	Show
1837	1917121..1917193	tRNA-Val	Show
1838	1917195..1917697	PP_01867; D-alanyl-lipoteichoic acid biosynthesis protein DltD	Show
1839	1917698..1918199	PP_01868; G5 domain-containing protein	Show
1840	1918205..1918699	PP_01869; HAD family phosphatase	Show
1841	1918700..1919198	PP_01870; isopeptide-forming domain-containing fimbrial protein	Show
1842	1919199..1919697	PP_01871; DUF308 domain-containing protein	Show
1843	1920276..1920692	PP_01873; HlyC/CorC family transporter	Show
1844	1921176..1921649	PP_01875; CPBP family intramembrane metalloprotease	Show
1845	1921654..1921919	PP_01876; transcriptional regulator	Show
1846	1921930..1922124	PP_01877; site-specific DNA-methyltransferase	Show
1847	1922125..1922326	PP_01878; type IV secretory system conjugative DNA transfer family protein	Show
1848	1922326..1922592	PP_01879; hypothetical protein	Show
1849	1923061..1923525	PP_01881; cell wall anchor protein	Show
1850	1923526..1923989	PP_01882; peptide ABC transporter ATP-binding protein	Show
1851	1923990..1924453	PP_01883; preprotein translocase subunit SecA	Show
1852	1924454..1924754	PP_01884; TrkH family potassium uptake protein	Show
1853	1925381..1925841	PP_01886; hypothetical protein	Show
1854	1925853..1926086	PP_01887; hypothetical protein	Show
1855	1926083..1926298	PP_01888; chemotaxis protein	Show
1856	1926299..1926583	PP_01889; phage tail family protein;phage tail family protein	Show
1857	1928180..1928560	PP_01891; hypothetical protein	Show
1858	1928659..1929001	PP_01892; site-specific integrase	Show
1859	1929002..1929432	PP_01893; helicase	Show
1860	1929433..1929862	PP_01894; isopeptide-forming domain-containing fimbrial protein	Show
1861	1929863..1930287	PP_01895; coenzyme F420-0:L-glutamate ligase	Show
1862	1930288..1930477	PP_01896; MerR family transcriptional regulator	Show
1863	1930514..1930710	PP_01897; glutamine synthetase	Show
1864	1930711..1930987	PP_01898; 7-cyano-7-deazaguanine synthase	Show
1865	1930987..1931132	PP_01899; 6-carboxytetrahydropterin synthase	Show
1866	1931133..1931533	PP_01900; glycoside hydrolase family 88 protein	Show
1867	1931555..1931974	PP_01901; tape measure domain-containing protein	Show
1868	1931975..1932393	PP_01902; PTS sugar transporter subunit IIC	Show
1869	1932394..1932811	PP_01903; class I tRNA ligase family protein	Show
1870	1932812..1933227	PP_01904; ATP-dependent nuclease subunit B	Show
1871	1934053..1934462	PP_01907; hypothetical protein	Show
1872	1934873..1935282	PP_01908; aminotransferase	Show
1873	1935283..1935689	PP_01909; CHAP domain-containing protein	Show
1874	1935690..1936096	PP_01910; oligosaccharide flippase family protein	Show
1875	1936097..1936502	PP_01911; DNA topology modulation protein	Show
1876	1936503..1936907	PP_01912; hypothetical protein	Show
1877	1936908..1937311	PP_01913; cation-efflux pump	Show
1878	1937397..1937715	PP_01914; immunity 51 family protein	Show
1879	1937716..1938119	PP_01915; aminopeptidase	Show
1880	1938124..1938520	PP_01916; 23S rRNA (uracil-5-)-methyltransferase RumA	Show
1881	1938521..1938881	PP_01917; NTPase	Show
1882	1938921..1939319	PP_01918; hypothetical protein	Show
1883	1939320..1939645	PP_01919; hypothetical protein	Show
1884	1939718..1940112	PP_01920; DEAD/DEAH box helicase	Show
1885	1940113..1940507	PP_01921; AAA family ATPase	Show
1886	1940508..1940901	PP_01922; single-stranded DNA-binding protein	Show
1887	1940902..1941204	PP_01923; phage capsid protein;phage capsid protein	Show
1888	1941293..1941683	PP_01924; pseudouridine synthase	Show
1889	1941684..1941962	PP_01925; SrtB family sortase	Show
1890	1942073..1942461	PP_01926; alpha-glycosidase	Show
1891	1942849..1943234	PP_01927; D-alanyl-lipoteichoic acid biosynthesis protein DltB	Show
1892	1943235..1943620	PP_01928; sensor histidine kinase	Show
1893	1943621..1944005	PP_01929; hypothetical protein	Show
1894	1944006..1944385	PP_01930; VWA domain-containing protein	Show
1895	1944386..1944707	PP_01931; minor capsid protein	Show
1896	1944765..1944974	PP_01932; CbrC family protein	Show
1897	1945142..1945518	PP_01933; CHAP domain-containing protein	Show
1898	1945519..1945894	PP_01934; hypothetical protein	Show
1899	1945895..1946089	PP_01935; PTS sugar transporter subunit IIC	Show
1900	1946076..1946270	PP_01936; PTS system mannose/fructose/sorbose family transporter subunit IID	Show
1901	1946271..1946450	PP_01937; hypothetical protein	Show
1902	1946463..1946645	PP_01938; hypothetical protein	Show
1903	1946646..1947020	PP_01939; PTS transporter subunit EIIC	Show
1904	1947021..1947395	PP_01940; adhesin	Show
1905	1947396..1947768	PP_01941; G5 domain-containing protein	Show
1906	1947769..1948141	PP_01942; ribonuclease J	Show
1907	1948142..1948488	PP_01943; helix-turn-helix domain-containing protein	Show
1908	1948515..1948714	PP_01944; 3-deoxy-7-phosphoheptulonate synthase	Show
1909	1948716..1948885	PP_01945; 3-deoxy-7-phosphoheptulonate synthase	Show
1910	1949254..1949617	PP_01947; ABC transporter permease	Show
1911	1949618..1949887	PP_01948; glutamine amidotransferase	Show
1912	1949892..1949979	PP_01949; purine-nucleoside phosphorylase	Show
1913	1949980..1950338	PP_01950; hypothetical protein	Show
1914	1950339..1950697	PP_01951; PTS beta-glucoside transporter subunit IIBCA	Show
1915	1950698..1951055	PP_01952; diphosphomevalonate decarboxylase	Show
1916	1951056..1951172	PP_01953; DUF898 domain-containing protein	Show
1917	1951215..1951412	PP_01954; DUF1912 family protein	Show
1918	1951413..1951769	PP_01955; ATP-grasp domain-containing protein	Show
1919	1951772..1952125	PP_01956; phosphoglycerate mutase family protein	Show
1920	1952126..1952481	PP_01957; hypothetical protein	Show
1921	1952482..1952836	PP_01958; restriction endonuclease subunit S	Show
1922	1952838..1953192	PP_01959; phosphoribosylamine--glycine ligase	Show
1923	1953214..1953546	PP_01960; UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	Show
1924	1953547..1953900	PP_01961; 50S ribosomal protein L2	Show
1925	1953914..1953985	tRNA-Gly	Show
1926	1953993..1954078	tRNA-Leu	Show
1927	1954090..1954163	tRNA-Arg	Show
1928	1954179..1954252	tRNA-Pro	Show
1929	1954254..1954606	PP_01962; MFS transporter	Show
1930	1954607..1954959	PP_01963; Cna B-type domain-containing protein	Show
1931	1954960..1955311	PP_01964; hypothetical protein	Show
1932	1955312..1955662	PP_01965; isopeptide-forming domain-containing fimbrial protein	Show
1933	1955663..1956012	PP_01966; ATP-binding cassette domain-containing protein	Show
1934	1956013..1956361	PP_01967; prealbumin-like fold domain-containing protein	Show
1935	1956362..1956710	PP_01968; CBS domain-containing protein	Show
1936	1956711..1956930	PP_01969; hypothetical protein	Show
1937	1957072..1957405	PP_01970; adaptor protein MecA	Show
1938	1957406..1957586	PP_01971; hypothetical protein	Show
1939	1958100..1958446	PP_01973; 3-isopropylmalate dehydrogenase	Show
1940	1958447..1958792	PP_01974; tape measure domain-containing protein	Show
1941	1958848..1959137	PP_01975; sensor histidine kinase	Show
1942	1959138..1959433	PP_01976; PLP-dependent aminotransferase family protein	Show
1943	1959483..1959826	PP_01977; Fe-S cluster assembly protein SufD	Show
1944	1959827..1960170	PP_01978; DNA repair protein RecN	Show
1945	1960171..1960513	PP_01979; hyaluronate lyase	Show
1946	1960514..1960854	PP_01980; replication initiation factor domain-containing protein	Show
1947	1960855..1961192	PP_01981; UDP-N-acetylglucosamine 2-epimerase	Show
1948	1961195..1961534	PP_01982; U32 family peptidase	Show
1949	1961591..1961874	PP_01983; ATPase	Show
1950	1961875..1962134	PP_01984; hypothetical protein	Show
1951	1962555..1962893	PP_01986; lipoate--protein ligase family protein	Show
1952	1962894..1963232	PP_01987; DUF859 domain-containing protein	Show
1953	1963233..1963571	PP_01988; serine hydrolase	Show
1954	1963572..1963909	PP_01989; PolC-type DNA polymerase III	Show
1955	1963910..1964247	PP_01990; dihydroorotate dehydrogenase electron transfer subunit	Show
1956	1964248..1964585	PP_01991; lipopolysaccharide cholinephosphotransferase	Show
1957	1964586..1964922	PP_01992; flavin reductase	Show
1958	1964924..1965061	PP_01993; 50S ribosomal protein L33	Show
1959	1965258..1965592	PP_01994; cytochrome c biogenesis protein CcdA	Show
1960	1965593..1965927	PP_01995; Na/Pi symporter	Show
1961	1965928..1966262	PP_01996; conjugal transfer protein TrbL	Show
1962	1966264..1966596	PP_01997; peptide-binding protein	Show
1963	1966614..1966930	PP_01998; ATP-binding cassette domain-containing protein	Show
1964	1967040..1967263	PP_01999; ATP-binding cassette domain-containing protein	Show
1965	1967264..1967476	PP_02000; ASCH domain-containing protein	Show
1966	1967595..1967924	PP_02002; sugar transferase	Show
1967	1968009..1968254	PP_02003; hypothetical protein	Show
1968	1968255..1968584	PP_02004; hypothetical protein	Show
1969	1968585..1968913	PP_02005; VWA domain-containing protein	Show
1970	1968914..1969241	PP_02006; ATP-binding cassette domain-containing protein	Show
1971	1969289..1969569	PP_02007; bacitracin ABC transporter ATP-binding protein	Show
1972	1969628..1969897	PP_02008; hypothetical protein	Show
1973	1970225..1970551	PP_02010; SHIRT domain-containing protein	Show
1974	1970552..1970877	PP_02011; aminopeptidase	Show
1975	1971004..1971202	PP_02012; DegV family protein	Show
1976	1971203..1971527	PP_02013; hypothetical protein	Show
1977	1971528..1971851	PP_02014; ATP-binding cassette domain-containing protein	Show
1978	1972114..1972182	tRNA-Glu	Show
1979	1972498..1972571	tRNA-Pro	Show
1980	1972577..1972650	tRNA-Met	Show
1981	1972664..1972737	tRNA-Met	Show
1982	1972821..1973143	PP_02016; AAA family ATPase	Show
1983	1973144..1973465	PP_02017; peptide ABC transporter ATP-binding protein	Show
1984	1973607..1973786	PP_02018; hypothetical protein	Show
1985	1973788..1974109	PP_02019; DUF4404 family protein	Show
1986	1974110..1974430	PP_02020; hypothetical protein	Show
1987	1974431..1974751	PP_02021; hypothetical protein	Show
1988	1974752..1975072	PP_02022; zeta toxin family protein	Show
1989	1975073..1975393	PP_02023; GTP cyclohydrolase I	Show
1990	1975394..1975713	PP_02024; ATP-binding cassette domain-containing protein	Show
1991	1975781..1976033	PP_02025; hypothetical protein	Show
1992	1976034..1976353	PP_02026; chorismate-binding protein	Show
1993	1976354..1976672	PP_02027; peptide ABC transporter ATP-binding protein	Show
1994	1976992..1977309	PP_02028; ATP-binding cassette domain-containing protein	Show
1995	1977628..1977945	PP_02030; bacteriophage Gp15 family protein;phage Gp15 family protein	Show
1996	1977946..1978262	PP_02031; adenylosuccinate synthetase	Show
1997	1978580..1978896	PP_02033; DNA gyrase subunit A	Show
1998	1978897..1979213	PP_02034; D-alanyl-lipoteichoic acid biosynthesis protein DltB	Show
1999	1979214..1979528	PP_02035; ABC transporter permease	Show
2000	1979529..1979843	PP_02036; hypothetical protein	Show
2001	1979844..1980158	PP_02037; HAD family hydrolase	Show
2002	1980515..1980727	PP_02039; hypothetical protein	Show
2003	1981102..1981414	PP_02041; 3-isopropylmalate dehydrogenase	Show
2004	1981415..1981727	PP_02042; DUF859 domain-containing protein	Show
2005	1981728..1982040	PP_02043; heavy metal translocating P-type ATPase	Show
2006	1982078..1982353	PP_02044; DUF1129 family protein	Show
2007	1982354..1982666	PP_02045; bifunctional folylpolyglutamate synthase/dihydrofolate synthase	Show
2008	1982808..1982978	PP_02046; PrgI family protein	Show
2009	1982979..1983289	PP_02047; aspartate carbamoyltransferase	Show
2010	1983290..1983599	PP_02048; G5 domain-containing protein	Show
2011	1983600..1983909	PP_02049; epoxyqueuosine reductase QueH	Show
2012	1983910..1984219	PP_02050; translation initiation factor IF-2	Show
2013	1984220..1984529	PP_02051; sensor histidine kinase	Show
2014	1984530..1984782	PP_02052; transposase	Show
2015	1984839..1985147	PP_02053; helicase	Show
2016	1985148..1985409	PP_02054; minor capsid protein	Show
2017	1985457..1985765	PP_02055; hypothetical protein	Show
2018	1985766..1986074	PP_02056; AAA family ATPase	Show
2019	1986153..1986381	PP_02057; ribitol-5-phosphate dehydrogenase	Show
2020	1986491..1986688	PP_02058; glutamine amidotransferase	Show
2021	1986689..1986946	PP_02059; multidrug efflux SMR transporter	Show
2022	1986995..1987299	PP_02060; hypothetical protein	Show
2023	1987300..1987604	PP_02061; DUF87 domain-containing protein	Show
2024	1987605..1987909	PP_02062; FAD-binding protein	Show
2025	1987910..1988213	PP_02063; hypothetical protein	Show
2026	1988214..1988517	PP_02064; helicase	Show
2027	1988518..1988821	PP_02065; ABC transporter ATP-binding protein	Show
2028	1988822..1989123	PP_02066; penicillin-binding protein 2	Show
2029	1989124..1989307	PP_02067; glycosyltransferase family 2 protein	Show
2030	1989426..1989726	PP_02068; adenylosuccinate lyase	Show
2031	1990028..1990327	PP_02069; CPBP family intramembrane metalloprotease	Show
2032	1990328..1990627	PP_02070; exodeoxyribonuclease	Show
2033	1990928..1991227	PP_02071; UDP-galactopyranose mutase	Show
2034	1991228..1991515	PP_02072; hypothetical protein	Show
2035	1991541..1991807	PP_02073; hypothetical protein	Show
2036	1991828..1992126	PP_02074; HD domain-containing protein	Show
2037	1992175..1992425	PP_02075; DUF5590 domain-containing protein	Show
2038	1992446..1992518	tRNA-Lys	Show
2039	1992581..1992724	PP_02076; DUF308 domain-containing protein	Show
2040	1993088..1993282	PP_02078; DUF3173 domain-containing protein	Show
2041	1993322..1993592	PP_02079; competence protein ComEC	Show
2042	1993593..1993890	PP_02080; peptidase	Show
2043	1993891..1994094	PP_02081; phage tail protein;phage tail protein	Show
2044	1994189..1994308	PP_02082; DNA mismatch repair protein MutT	Show
2045	1994337..1994486	PP_02083; TipAS antibiotic-recognition domain-containing protein	Show
2046	1994785..1995082	PP_02085; FAD-binding protein	Show
2047	1995083..1995379	PP_02086; MFS transporter	Show
2048	1995487..1995676	PP_02087; virulence factor MviN	Show
2049	1995677..1995862	PP_02088; cell envelope biogenesis protein OmpA	Show
2050	1995974..1996269	PP_02089; cobalt ABC transporter permease	Show
2051	1996270..1996565	PP_02090; hypothetical protein	Show
2052	1996566..1996860	PP_02091; ATP-grasp domain-containing protein	Show
2053	1996861..1997154	PP_02092; transposase	Show
2054	1997155..1997447	PP_02093; 1-acyl-sn-glycerol-3-phosphate acyltransferase	Show
2055	1997448..1997674	PP_02094; CPBP family intramembrane metalloprotease	Show
2056	1998034..1998325	PP_02096; ABC transporter substrate-binding protein	Show
2057	1998342..1998617	PP_02097; alanine racemase	Show
2058	1998909..1999198	PP_02098; hypothetical protein	Show
2059	1999199..1999488	PP_02099; NAD-dependent epimerase/dehydratase family protein	Show
2060	1999489..1999777	PP_02100; hypothetical protein	Show
2061	1999832..2000066	PP_02101; hypothetical protein	Show
2062	2000356..2000643	PP_02103; DUF2268 domain-containing protein	Show
2063	2000644..2000931	PP_02104; tyrosine-type recombinase/integrase	Show
2064	2001316..2001507	PP_02106; hypothetical protein	Show
2065	2001508..2001795	PP_02107; DUF1351 domain-containing protein	Show
2066	2001796..2001979	PP_02108; hypothetical protein	Show
2067	2002084..2002370	PP_02109; aminotransferase class V-fold PLP-dependent enzyme	Show
2068	2002413..2002657	PP_02110; CoA-binding protein	Show
2069	2002658..2002944	PP_02111; hypothetical protein	Show
2070	2003231..2003515	PP_02112; ribose-phosphate diphosphokinase	Show
2071	2003516..2003800	PP_02113; UTRA domain-containing protein	Show
2072	2003801..2004085	PP_02114; MBL fold metallo-hydrolase	Show
2073	2004086..2004369	PP_02115; MutR family transcriptional regulator	Show
2074	2004370..2004652	PP_02116; excinuclease ABC subunit C	Show
2075	2004747..2004935	PP_02117; hypothetical protein	Show
2076	2004936..2005218	PP_02118; class A beta-lactamase-related serine hydrolase	Show
2077	2005219..2005500	PP_02119; hypothetical protein	Show
2078	2005501..2005782	PP_02120; alpha-glycosidase	Show
2079	2005783..2006064	PP_02121; hypothetical protein	Show
2080	2006065..2006346	PP_02122; HEAT repeat domain-containing protein	Show
2081	2006347..2006469	PP_02123; 7-carboxy-7-deazaguanine synthase QueE	Show
2082	2006488..2006627	PP_02124; NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	Show
2083	2006628..2006907	PP_02125; ribose-phosphate pyrophosphokinase	Show
2084	2006908..2007187	PP_02126; site-specific integrase	Show
2085	2007188..2007467	PP_02127; hypothetical protein	Show
2086	2007468..2007746	PP_02128; isopeptide-forming domain-containing fimbrial protein	Show
2087	2008187..2008301	PP_02130; HAD family hydrolase	Show
2088	2008302..2008578	PP_02131; hypothetical protein	Show
2089	2008859..2009131	PP_02133; LicD family protein	Show
2090	2009132..2009407	PP_02134; 3-deoxy-7-phosphoheptulonate synthase	Show
2091	2009959..2010233	PP_02135; formate--tetrahydrofolate ligase	Show
2092	2010234..2010508	PP_02136; hypothetical protein	Show
2093	2010509..2010783	PP_02137; hypothetical protein	Show
2094	2010792..2011058	PP_02138; oligohyaluronate lyase	Show
2095	2011334..2011607	PP_02139; hypothetical protein	Show
2096	2011608..2011880	PP_02140; MBL fold metallo-hydrolase	Show
2097	2012180..2012426	PP_02141; SPFH domain-containing protein	Show
2098	2012447..2012698	PP_02142; 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	Show
2099	2012699..2012970	PP_02143; hypothetical protein	Show
2100	2012971..2013242	PP_02144; glycoside hydrolase family 125 protein	Show
2101	2013515..2013786	PP_02145; peptidase M42	Show
2102	2013945..2014058	PP_02146; amino acid ABC transporter ATP-binding protein	Show
2103	2014059..2014330	PP_02147; Na/Pi symporter	Show
2104	2014331..2014601	PP_02148; PTS system mannose/fructose/sorbose family transporter subunit IID	Show
2105	2014602..2014872	PP_02149; hypothetical protein	Show
2106	2014873..2015143	PP_02150; N-acetylmuramoyl-L-alanine amidase	Show
2107	2015144..2015413	PP_02151; type I pullulanase	Show
2108	2015414..2015563	PP_02152; CPBP family intramembrane metalloprotease	Show
2109	2015684..2015953	PP_02153; ATP-binding cassette domain-containing protein	Show
2110	2015980..2016223	PP_02154; hypothetical protein	Show
2111	2016251..2016493	PP_02155; uracil permease	Show
2112	2016494..2016763	PP_02156; HAD-IC family P-type ATPase	Show
2113	2017572..2017840	PP_02157; primosomal protein N'	Show
2114	2017841..2018109	PP_02158; bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	Show
2115	2018110..2018333	PP_02159; aldose epimerase	Show
2116	2018648..2018915	PP_02161; transporter substrate-binding domain-containing protein	Show
2117	2018916..2019183	PP_02162; DEAD/DEAH box helicase family protein	Show
2118	2019184..2019382	PP_02163; bacteriophage Gp15 family protein;phage Gp15 family protein	Show
2119	2019452..2019718	PP_02164; DEAD/DEAH box helicase	Show
2120	2019986..2020252	PP_02165; glycosyltransferase	Show
2121	2020253..2020512	PP_02166; AI-2E family transporter	Show
2122	2020519..2020776	PP_02167; MFS transporter	Show
2123	2020785..2020991	PP_02168; ABC transporter ATP-binding protein	Show
2124	2021685..2021841	PP_02170; bifunctional folylpolyglutamate synthase/dihydrofolate synthase	Show
2125	2021842..2022104	PP_02171; phosphohydrolase	Show
2126	2022105..2022359	PP_02172; hypothetical protein	Show
2127	2022368..2022630	PP_02173; DNA topoisomerase I	Show
2128	2022631..2022893	PP_02174; cytochrome c	Show
2129	2022894..2023155	PP_02175; cell wall-binding protein	Show
2130	2023156..2023417	PP_02176; amino acid ABC transporter substrate-binding protein	Show
2131	2023418..2023558	PP_02177; ferrichrome ABC transporter permease	Show
2132	2023548..2023679	PP_02178; iron chelate uptake ABC transporter family permease subunit	Show
2133	2023680..2023941	PP_02179; cache domain-containing protein	Show
2134	2023942..2024203	PP_02180; anthranilate phosphoribosyltransferase	Show
2135	2024466..2024727	PP_02181; hydroxyethylthiazole kinase	Show
2136	2024989..2025249	PP_02183; purine-nucleoside phosphorylase	Show
2137	2025250..2025510	PP_02184; relaxase/mobilization nuclease domain-containing protein	Show
2138	2025511..2025771	PP_02185; YidC/Oxa1 family membrane protein insertase	Show
2139	2025772..2026032	PP_02186; transporter substrate-binding domain-containing protein	Show
2140	2026294..2026554	PP_02187; 2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	Show
2141	2026869..2027075	PP_02188; accessory Sec system glycosyltransferase Asp1	Show
2142	2027076..2027332	PP_02189; magnesium transporter CorA family protein	Show
2143	2027336..2027568	PP_02190; methionine ABC transporter ATP-binding protein	Show
2144	2027596..2027801	PP_02191; hypothetical protein	Show
2145	2027855..2028113	PP_02192; prepilin peptidase	Show
2146	2028114..2028260	PP_02193; phosphomevalonate kinase	Show
2147	2028244..2028372	PP_02194; type 2 isopentenyl-diphosphate Delta-isomerase	Show
2148	2028373..2028631	PP_02195; penicillin-binding protein	Show
2149	2028921..2029149	PP_02197; adenylosuccinate synthetase	Show
2150	2029150..2029407	PP_02198; alpha-ketoacid dehydrogenase subunit beta	Show
2151	2029666..2029859	PP_02199; peptide deformylase	Show
2152	2029924..2030118	PP_02200; F0F1 ATP synthase subunit A	Show
2153	2030182..2030439	PP_02201; MFS transporter	Show
2154	2030440..2030697	PP_02202; ABC transporter permease subunit	Show
2155	2030698..2030955	PP_02203; NUDIX domain-containing protein	Show
2156	2030956..2031213	PP_02204; sodium-dependent transporter	Show
2157	2031214..2031438	PP_02205; DUF421 domain-containing protein	Show
2158	2031730..2031922	PP_02206; hypothetical protein	Show
2159	2031988..2032245	PP_02207; YfbM family protein	Show
2160	2032246..2032502	PP_02208; isopeptide-forming domain-containing fimbrial protein	Show
2161	2032503..2032759	PP_02209; sensor histidine kinase	Show
2162	2032760..2033016	PP_02210; gamma-glutamyl-phosphate reductase	Show
2163	2033017..2033273	PP_02211; hypothetical protein	Show
2164	2033274..2033530	PP_02212; pyridoxal-phosphate dependent enzyme	Show
2165	2033788..2034044	PP_02214; multidrug ABC transporter permease/ATP-binding protein	Show
2166	2034045..2034301	PP_02215; FMN-binding protein	Show
2167	2034302..2034497	PP_02216; sensor histidine kinase	Show
2168	2034590..2034813	PP_02217; hypothetical protein	Show
2169	2035426..2035581	PP_02219; SAP domain-containing protein	Show
2170	2035582..2035837	PP_02220; ABC transporter permease	Show
2171	2035838..2036091	PP_02221; NUDIX domain-containing protein	Show
2172	2036094..2036349	PP_02222; CPBP family intramembrane metalloprotease	Show
2173	2036350..2036605	PP_02223; hypothetical protein	Show
2174	2036606..2036860	PP_02224; MBL fold metallo-hydrolase	Show
2175	2036861..2037115	PP_02225; GNAT family N-acetyltransferase	Show
2176	2037171..2037370	PP_02226; putative DNA-binding protein	Show
2177	2037371..2037625	PP_02227; aldose 1-epimerase family protein	Show
2178	2037626..2037880	PP_02228; tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	Show
2179	2037881..2038135	PP_02229; ferrochelatase	Show
2180	2038136..2038358	PP_02230; adenylosuccinate synthetase	Show
2181	2038391..2038645	PP_02231; ROK family protein	Show
2182	2038646..2038855	PP_02232; hypothetical protein	Show
2183	2038901..2039144	PP_02233; SDR family NAD(P)-dependent oxidoreductase	Show
2184	2039156..2039347	PP_02234; DUF2513 domain-containing protein	Show
2185	2039344..2039409	PP_02235; DUF2513 domain-containing protein	Show
2186	2039410..2039663	PP_02236; carbamoyl-phosphate synthase large subunit	Show
2187	2039758..2039917	PP_02237; rRNA (guanine-N1)-methyltransferase	Show
2188	2039918..2040113	PP_02238; 23S rRNA (uracil-5-)-methyltransferase RumA	Show
2189	2040172..2040425	PP_02239; pyridoxal 5'-phosphate synthase glutaminase subunit PdxT	Show
2190	2040426..2040679	PP_02240; hypothetical protein	Show
2191	2040680..2040933	PP_02241; enoyl-CoA hydratase	Show
2192	2040934..2041187	PP_02242; pneumococcal-type histidine triad protein	Show
2193	2041247..2041441	PP_02243; hypothetical protein	Show
2194	2041469..2041621	PP_02244; hypothetical protein	Show
2195	2041754..2041948	PP_02245; hypothetical protein	Show
2196	2041949..2042201	PP_02246; endopeptidase	Show
2197	2042202..2042454	PP_02247; L-serine ammonia-lyase, iron-sulfur-dependent, subunit beta	Show
2198	2042624..2042707	PP_02249; LrgB family protein	Show
2199	2042708..2042960	PP_02250; transporter substrate-binding domain-containing protein	Show
2200	2043026..2043212	PP_02251; DUF2207 domain-containing protein	Show
2201	2043213..2043464	PP_02252; SrtB family sortase	Show
2202	2043465..2043716	PP_02253; protein kinase	Show
2203	2043717..2043968	PP_02254; deoxyribose-phosphate aldolase	Show
2204	2043969..2044220	PP_02255; DUF438 domain-containing protein	Show
2205	2044221..2044472	PP_02256; hydroxymethylglutaryl-CoA synthase	Show
2206	2044473..2044724	PP_02257; ABC transporter permease	Show
2207	2044725..2044976	PP_02258; FtsW/RodA/SpoVE family cell cycle protein	Show
2208	2044977..2045228	PP_02259; oligosaccharide flippase family protein	Show
2209	2045519..2045731	PP_02260; ATP-binding cassette domain-containing protein	Show
2210	2045732..2045982	PP_02261; replicative DNA helicase	Show
2211	2045983..2046233	PP_02262; gamma-glutamyl-phosphate reductase	Show
2212	2046234..2046484	PP_02263; hypothetical protein	Show
2213	2046517..2046696	PP_02264; hypothetical protein	Show
2214	2046738..2046986	PP_02265; phage capsid protein;phage capsid protein	Show
2215	2046987..2047237	PP_02266; hypothetical protein	Show
2216	2047247..2047468	PP_02267; helix-turn-helix domain-containing protein	Show
2217	2047738..2047987	PP_02268; oligoendopeptidase F	Show
2218	2047988..2048237	PP_02269; PTS glucose/maltose transporter subunit IIBCA	Show
2219	2048238..2048487	PP_02270; hypothetical protein	Show
2220	2048488..2048669	PP_02271; carboxylate--amine ligase	Show
2221	2048738..2048986	PP_02272; helix-turn-helix domain-containing protein	Show
2222	2049298..2049484	PP_02273; PI-2 pilus system signal peptidase SipA	Show
2223	2049485..2049733	PP_02274; PTS transporter subunit EIIC	Show
2224	2049734..2049982	PP_02275; ATP-dependent Clp protease proteolytic subunit ClpP	Show
2225	2049983..2050231	PP_02276; ATP-binding protein	Show
2226	2050232..2050480	PP_02277; glycerate kinase	Show
2227	2050481..2050700	PP_02278; hypothetical protein	Show
2228	2050730..2050977	PP_02279; phage portal protein;phage portal protein	Show
2229	2050978..2051225	PP_02280; 23S rRNA (uracil-5-)-methyltransferase RumA	Show
2230	2051474..2051721	PP_02282; MATE family efflux transporter	Show
2231	2051722..2051968	PP_02283; LCP family protein	Show
2232	2052216..2052462	PP_02285; UDP-N-acetylglucosamine 1-carboxyvinyltransferase	Show
2233	2052463..2052709	PP_02286; endonuclease	Show
2234	2053000..2053202	PP_02287; hypothetical protein	Show
2235	2053203..2053448	PP_02288; two-component sensor histidine kinase	Show
2236	2053449..2053694	PP_02289; tRNA (adenine(22)-N(1))-methyltransferase TrmK	Show
2237	2053695..2053940	PP_02290; GMP synthase (glutamine-hydrolyzing)	Show
2238	2053941..2054186	PP_02291; homoserine kinase	Show
2239	2054463..2054677	PP_02293; peptidase M42	Show
2240	2054678..2054922	PP_02294; hypothetical protein	Show
2241	2054923..2055167	PP_02295; CBS domain-containing protein	Show
2242	2055168..2055412	PP_02296; CoA-disulfide reductase	Show
2243	2055413..2055657	PP_02297; hypothetical protein	Show
2244	2055658..2055902	PP_02298; E1-E2 ATPase	Show
2245	2055962..2056147	PP_02299; ATP-binding protein	Show
2246	2056148..2056392	PP_02300; DNA polymerase	Show
2247	2056393..2056637	PP_02301; bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase PurH	Show
2248	2056883..2057126	PP_02302; hypothetical protein	Show
2249	2057127..2057370	PP_02303; hypothetical protein	Show
2250	2057371..2057614	PP_02304; 4-alpha-glucanotransferase	Show
2251	2057615..2057858	PP_02305; ATP-binding cassette domain-containing protein	Show
2252	2057890..2058102	PP_02306; DEAD/DEAH box helicase	Show
2253	2058103..2058346	PP_02307; amino acid permease	Show
2254	2058347..2058582	PP_02308; glycosyltransferase	Show
2255	2058590..2058832	PP_02309; peptide ABC transporter permease	Show
2256	2058833..2059075	PP_02310; phosphoglycerate kinase	Show
2257	2059076..2059318	PP_02311; glucohydrolase	Show
2258	2059319..2059561	PP_02312; A/G-specific adenine glycosylase	Show
2259	2059562..2059804	PP_02313; cell wall-binding protein	Show
2260	2060048..2060289	PP_02315; ribose-phosphate pyrophosphokinase	Show
2261	2060290..2060531	PP_02316; aldose 1-epimerase family protein	Show
2262	2060532..2060773	PP_02317; ABC transporter ATP-binding protein	Show
2263	2060774..2060943	PP_02318; purine permease	Show
2264	2061016..2061257	PP_02319; tryptophan synthase subunit alpha	Show
2265	2061500..2061740	PP_02320; G5 domain-containing protein	Show
2266	2061741..2061981	PP_02321; CPBP family intramembrane metalloprotease	Show
2267	2061982..2062222	PP_02322; UDP-galactopyranose mutase	Show
2268	2062255..2062463	PP_02323; hypothetical protein	Show
2269	2062946..2063185	PP_02324; histidine kinase	Show
2270	2063186..2063425	PP_02325; MarR family transcriptional regulator	Show
2271	2063426..2063665	PP_02326; 1,4-alpha-glucan branching enzyme	Show
2272	2063906..2064145	PP_02327; aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	Show
2273	2064146..2064385	PP_02328; peptide ABC transporter ATP-binding protein	Show
2274	2064386..2064625	PP_02329; asparagine--tRNA ligase	Show
2275	2064626..2064753	PP_02330; cation-efflux pump	Show
2276	2064866..2064958	PP_02331; type II CRISPR-associated endonuclease Cas1	Show
2277	2065106..2065345	PP_02332; guanylate kinase	Show
2278	2066068..2066140	tRNA-Val	Show
2279	2066305..2066543	PP_02334; D-alanyl-lipoteichoic acid biosynthesis protein DltB	Show
2280	2066544..2066782	PP_02335; glycosyltransferase	Show
2281	2066783..2067021	PP_02336; relaxase/mobilization nuclease domain-containing protein	Show
2282	2067261..2067499	PP_02337; glycoside hydrolase family 95 protein	Show
2283	2067500..2067721	PP_02338; hypothetical protein	Show
2284	2067739..2067920	PP_02339; hypothetical protein	Show
2285	2068217..2068454	PP_02340; G5 domain-containing protein	Show
2286	2068455..2068692	PP_02341; HlyC/CorC family transporter	Show
2287	2068693..2068930	PP_02342; 3-isopropylmalate dehydratase small subunit	Show
2288	2068931..2069168	PP_02343; preprotein translocase subunit SecY	Show
2289	2069169..2069406	PP_02344; SLOG family protein	Show
2290	2069407..2069644	PP_02345; ribose-phosphate pyrophosphokinase-like domain-containing protein	Show
2291	2069645..2069882	PP_02346; TIGR01212 family radical SAM protein	Show
2292	2069883..2070120	PP_02347; GNAT family N-acetyltransferase	Show
2293	2070359..2070596	PP_02348; pyrimidine-nucleoside phosphorylase	Show
2294	2070597..2070834	PP_02349; DNA cytosine methyltransferase	Show
2295	2070835..2071071	PP_02350; SIS domain-containing protein	Show
2296	2071072..2071308	PP_02351; glucohydrolase	Show
2297	2071322..2071545	PP_02352; nicotinate-nucleotide adenylyltransferase	Show
2298	2071546..2071782	PP_02353; DUF2130 domain-containing protein	Show
2299	2071783..2072019	PP_02354; NAD-dependent epimerase/dehydratase family protein	Show
2300	2072020..2072256	PP_02355; LicD family protein	Show
2301	2072257..2072493	PP_02356; RNA polymerase sigma factor RpoD	Show
2302	2072494..2072729	PP_02357; SufD family Fe-S cluster assembly protein	Show
2303	2072730..2072965	PP_02358; redox-regulated ATPase YchF	Show
2304	2073910..2074144	PP_02361; hypothetical protein	Show
2305	2074412..2074614	PP_02362; acyltransferase domain-containing protein	Show
2306	2074615..2074849	PP_02363; PTS transporter subunit EIIC	Show
2307	2074850..2075084	PP_02364; ATP-binding cassette domain-containing protein	Show
2308	2075320..2075553	PP_02366; helix-turn-helix domain-containing protein	Show
2309	2075554..2075658	PP_02367; PTS mannose/fructose/sorbose/N-acetylgalactosamine transporter subunit IIC	Show
2310	2075673..2075787	PP_02368; PTS N-acetylgalactosamine transporter subunit IIB	Show
2311	2075788..2076021	PP_02369; AMP-binding protein	Show
2312	2076022..2076255	PP_02370; peptidoglycan N-acetylglucosamine deacetylase	Show
2313	2076256..2076489	PP_02371; dihydrolipoyl dehydrogenase	Show
2314	2076490..2076723	PP_02372; nucleotidyltransferase domain-containing protein	Show
2315	2076724..2076957	PP_02373; EamA/RhaT family transporter	Show
2316	2076958..2077190	PP_02374; heavy metal translocating P-type ATPase	Show
2317	2077453..2077656	PP_02375; peptidase	Show
2318	2077657..2077889	PP_02376; DUF4417 domain-containing protein	Show
2319	2077890..2078122	PP_02377; fibronectin-binding SSURE repeat-containing protein	Show
2320	2078123..2078355	PP_02378; TenA family protein	Show
2321	2078356..2078588	PP_02379; ROK family protein	Show
2322	2078822..2079002	PP_02381; ATP-dependent Clp protease proteolytic subunit	Show
2323	2079055..2079287	PP_02382; SAM-dependent methyltransferase	Show
2324	2079754..2079986	PP_02383; hypothetical protein	Show
2325	2079987..2080218	PP_02384; site-specific integrase	Show
2326	2080219..2080450	PP_02385; peptide ABC transporter ATP-binding protein	Show
2327	2080451..2080682	PP_02386; hypothetical protein	Show
2328	2080683..2080914	PP_02387; phosphatidate cytidylyltransferase	Show
2329	2080915..2081146	PP_02388; iron chelate uptake ABC transporter family permease subunit	Show
2330	2081147..2081378	PP_02389; hypothetical protein	Show
2331	2081379..2081610	PP_02390; GDP-mannose 4,6-dehydratase	Show
2332	2081611..2081842	PP_02391; Holliday junction branch migration DNA helicase RuvB	Show
2333	2081843..2082074	PP_02392; glycosyltransferase	Show
2334	2082075..2082282	PP_02393; alpha-glycosidase	Show
2335	2082655..2082770	PP_02395; GNAT family N-acetyltransferase	Show
2336	2082771..2083002	PP_02396; RsmD family RNA methyltransferase	Show
2337	2083003..2083233	PP_02397; cell division protein FtsK	Show
2338	2083234..2083464	PP_02398; ABC transporter ATP-binding protein	Show
2339	2083465..2083695	PP_02399; branched-chain amino acid transport system II carrier protein	Show
2340	2083696..2083926	PP_02400; hypothetical protein	Show
2341	2083927..2084157	PP_02401; hypothetical protein	Show
2342	2084158..2084245	PP_02402; DNA-formamidopyrimidine glycosylase	Show
2343	2084245..2084388	PP_02403; dephospho-CoA kinase	Show
2344	2084424..2084619	PP_02404; thiamine-binding protein	Show
2345	2085082..2085312	PP_02406; starch synthase	Show
2346	2085544..2085773	PP_02407; type II CRISPR-associated endonuclease Cas1	Show
2347	2085774..2086003	PP_02408; exonuclease RexA	Show
2348	2086004..2086233	PP_02409; GNAT family N-acetyltransferase	Show
2349	2086234..2086463	PP_02410; LacI family transcriptional regulator	Show
2350	2086464..2086693	PP_02411; PhoH family protein	Show
2351	2086924..2087153	PP_02413; aromatic acid exporter family protein	Show
2352	2087384..2087582	PP_02414; preprotein translocase subunit SecY	Show
2353	2087614..2087842	PP_02415; isopeptide-forming domain-containing fimbrial protein	Show
2354	2088072..2088300	PP_02416; ATPase	Show
2355	2088301..2088529	PP_02417; adhesion protein	Show
2356	2088530..2088758	PP_02418; nucleotidyltransferase family protein	Show
2357	2088771..2088987	PP_02419; thiamine diphosphokinase	Show
2358	2088988..2089216	PP_02420; TIGR01457 family HAD-type hydrolase	Show
2359	2089217..2089445	PP_02421; SAM-dependent DNA methyltransferase	Show
2360	2089506..2089674	PP_02422; 4'-phosphopantetheinyl transferase superfamily protein	Show
2361	2089904..2090132	PP_02423; N-acetylmuramoyl-L-alanine amidase family protein	Show
2362	2090184..2090361	PP_02424; glucokinase	Show
2363	2090362..2090590	PP_02425; DegV family protein	Show
2364	2091965..2092192	PP_02429; peptidylprolyl isomerase	Show
2365	2092421..2092648	PP_02430; hypothetical protein	Show
2366	2092649..2092876	PP_02431; AAA family ATPase	Show
2367	2092925..2093104	PP_02432; polyketide cyclase	Show
2368	2093105..2093202	PP_02433; Fe-Mn family superoxide dismutase	Show
2369	2093333..2093560	PP_02434; hypothetical protein	Show
2370	2093561..2093788	PP_02435; VWA domain-containing protein	Show
2371	2093789..2094016	PP_02436; hypothetical protein	Show
2372	2094245..2094441	PP_02437; hypothetical protein	Show
2373	2094701..2094927	PP_02439; gamma-glutamylcysteine synthetase	Show
2374	2094987..2095154	PP_02440; ATP-binding protein	Show
2375	2095155..2095381	PP_02441; hypothetical protein	Show
2376	2095382..2095608	PP_02442; substrate-binding domain-containing protein	Show
2377	2095609..2095835	PP_02443; branched-chain amino acid ABC transporter permease	Show
2378	2095836..2096062	PP_02444; nitroreductase family protein	Show
2379	2096063..2096289	PP_02445; ABC transporter permease	Show
2380	2096290..2096516	PP_02446; magnesium transporter CorA family protein	Show
2381	2096517..2096662	PP_02447; acetyl-CoA C-acyltransferase	Show
2382	2096971..2097197	PP_02448; ribosome recycling factor	Show
2383	2097198..2097401	PP_02449; hypothetical protein	Show
2384	2097425..2097651	PP_02450; TrkH family potassium uptake protein	Show
2385	2097652..2097862	PP_02451; hypothetical protein	Show
2386	2097879..2098105	PP_02452; DUF2992 family protein	Show
2387	2098146..2098332	PP_02453; hypothetical protein	Show
2388	2098333..2098558	PP_02454; elongation factor P	Show
2389	2098559..2098653	PP_02455; aminoacyl-tRNA hydrolase	Show
2390	2098785..2099010	PP_02456; zinc ABC transporter substrate-binding protein	Show
2391	2099028..2099236	PP_02457; hypothetical protein	Show
2392	2099237..2099462	PP_02458; ABC transporter permease	Show
2393	2099463..2099688	PP_02459; hypothetical protein	Show
2394	2099915..2100094	PP_02460; hypothetical protein	Show
2395	2100161..2100366	PP_02461; metallophosphoesterase	Show
2396	2100593..2100818	PP_02462; fibronectin-binding SSURE repeat-containing protein	Show