PHASTEST

Remember Me

Submission Results

Sequence Name: Not Available

GenBank Accession Number: CABMJE000000000

Download Results: CABMJE000000000.PHASTEST.zip

Region Summary
Phage Genes
Bacterial Genes
Genome Viewer 2.0

gi|00000000|ref|NC_000000| gi||ref|| Lactobacillus acidophilus isolate MGYG-HGUT-02379 genome assembly, 2009507, gc%: 34.60%

Download summary as .txt file:summary.txt

Total:1 prophage regions have been identified, of which 1 regions are intact, 0 regions are incomplete, and 0 regions are questionable.

Region	Region Length	Completeness	Score	# Total Proteins	Region Position	Most Common Phage	GC %	Details
contig,3,at,530254
1	4.5Kb	intact	95	7	829-5381	PHAGE_Entero_lato_NC_001422(7)	44.41%	Show

Region DNA

>1	 contig,3,at,530254:829-5381
TCACTTAAGTGGCTGGAGACAAATAATCTCTTTAATAACCTGATTCAGCGAAACCAATCC
GCGGCATTTAGTAGCGGTAAAGTTAGACCAAACCATGAAACCAACATAAACATTATTGCC
CGGCGTACGGGGAAGGACGTCAATAGTCACACAGTCCTTGACGGTATAATAACCACCATC
ATGGCGACCATCCAAAGGATAAACATCATAGGCAGTCGGGAGGGTAGTCGGAACCGAAGA
AGACTCAAAGCGAACCAAACAGGCAAAAAATTTAGGGTCGGCATCAAAAGCAATATCAGC
ACCAACAGAAACAACCTGATTAGCGGCGTTGACAGATGTATCCATCTGAATGCAATGAAG
AAAACCACCATTACCAGCATTAACCGTCAAACTATCAAAATATAACGTTGACGATGTAGC
TTTAGGTGTCTGTAAAACAGGTGCCGAAGAAGCTGGAGTAACAGAAGTGAGAACCAGCTT
ATCAGAAAAAAAGTTTGAATTATGGCGAGAAATAAAAGTCTGAAACATGATTAAACTCCT
AAGCAGAAAACCTACCGCGCTTCGCTTGGTCAACCCCTCAGCGGCAAAAATTAAAATTTT
TACCGCTTCGGCGTTATAACCTCACACTCAATCTTTTATCACGAAGTCATGATTGAATCG
CGAGTGGTCGGCAGATTGCGATAAACGGTCACATTAAATTTAACCTGACTATTCCACTGC
AACAACTGAACGGACTGGAAACACTGGTCATAATCATGGTGGCGAATAAGTACGCGTTCT
TGCAAATCACCAGAAGGCGGTTCCTGAATGAATGGGAAGCCTTCAAGAAGGTGATAAGCA
GGAGAAACATACGAAGGCGCATAACGATACCACTGACCCTCAGCAATCTTAAACTTCTTA
GACGAATCACCAGAACGGAAAACATCCTTCATAGAAATTTCACGCGGCGGCAAGTTGCCA
TACAAAACAGGGTCGCCAGCAATATCGGTATAAGTCAAAGCACCTTTAGCGTTAAGGTAC
TGAATCTCTTTAGTCGCAGTAGGCGGAAAACGAACAAGCGCAAGAGTAAACATAGTGCCA
TGCTCAGGAACAAAGAAACGCGGCACAGAATGTTTATAGGTCTGTTGAACACGACCAGAA
AACTGGCCTAACGACGTTTGGTCAGTTCCATCAACATCATAGCCAGATGCCCAGAGATTA
GAGCGCATGACAAGTAAAGGACGGTTGTCAGCGTCATAAGAGGTTTTACCTCCAAATGAA
GAAATAACATCATGGTAACGCTGCATGAAGTAATCACGTTCTTGGTCAGTATGCAAATTA
GCATAAGCAGCTTGCAGACCCATAATGTCAATAGATGTGGTAGAAGTCGTCATTTGGCGA
GAAAGCTCAGTCTCAGGAGGAAGCGGAGCAGTCCAAATGTTTTTGAGATGGCAGCAACGG
AAACCATAACGAGCATCATCTTGATTAAGCTCATTAGGGTTAGCCTCGGTACGGTCAGGC
ATCCACGGCGCTTTAAAATAGTTGTTATAGATATTCAAATAACCCTGAAACAAATGCTTA
GGGATTTTATTGGTATCAGGGTTAATCGTGCCAAGAAAAGCGGCATGGTCAATATAACCA
GTAGTGTTAACAGTCGGGAGAGGAGTGGCATTAACACCATCCTTCATGAACTTAATCCAC
TGTTCACCATAAACGTGACGATGAGGGACATAAAAAGTAAAAATGTCTACAGTAGAGTCA
ATAGCAAGGCCACGACGCAATGGAGAAAGACGGAGAGCGCCAACGGCGTCCATCTCGAAG
GAGTCGCCAGCGATAACCGGAGTAGTTGAAATGGTAATAAGACGACCAATCTGACCAGCA
AGGAAGCCAAGATGGGAAAGGTCATGCGGCATACGCTCGGCGCCAGTTTGAATATTAGAC
ATAATTTATCCTCAAGTAAGGGGCCGAAGCCCCTGCAATTAAAATTGTTGACCACCTACA
TACCAAAGACGAGCGCCTTTACGCTTGCCTTTAGTACCTCGCAACGGCTGCGGACGACCA
GGGCGAGCGCCAGAACGTTTTTTACCTTTAGACATTACATCACTCCTTCTGCACGTAATT
TTTGACGCACGTTTTCTTCTGCGTCAGTAAGAACGTCAGTGTTTCCTGCGCGTACACGCA
AGGTAAACGCGAACAATTCAGCGGCTTTAACCGGACGCTCGACGCCATTAATAATGTTTT
CCGTAAATTCAGCGCCTTCCATGATGAGACAGGCCGTTTGAATGTTGACGGGATGAACAT
AATAAGCAATGACGGCAGCAATAAACTCAACAGGAGCAGGAAAGCGAGGGTATCCTACAA
AGTCCAGCGTACCATAAACGCAAGCCTCAACGCAGCGACGAGCACGAGAGCGGTCAGTAG
CAATCCAAACTTTGTTACTCGTCAGAAAATCGAAATCATCTTCGGTTAAATCCAAAACGG
CAGAAGCCTGAATGAGCTTAATAGAGGCCAAAGCGGTCTGGAAACGTACGGATTGTTCAG
TAACTTGACTCATGATTTCTTACCTATTAGTGGTTGAACAGCATCGGACTCAGATAGTAA
TCCACGCTCTTTTAAAATGTCAACAAGAGAATCTCTACCATGAACAAAATGTGACTCATA
TCTAAACCAGTCCTTGACGAACGTGCCAAGCATATTAAGCCACTTCTCCTCATCCAACGC
GTCAGTTTTTGACAGAATCGTTAGTTGATGGCGAAAGGTCGCAAAGTAAGAGCTTCTCGA
GCTGCGCAAGGATAGGTCGAATTTTCTCATTTTCCGCCAGCAGTCCACTTCGATTTAATT
CGTAAACAAGCAGTAGTAATTCCTGCTTTATCAAGATAATTTTTCGACTCATCAGAAATA
TCCGAAAGTGTTAACTTCTGCGTCATGGAAGCGATAAAACTCTGCAGGTTGGATACGCCA
ATCATTTTTATCGAAGCGCGCATAAATTTGAGCAGATTTGTCGTCACAGGTTGCGCCGCC
AAAACGTCGGCTACAGTAACTTTTCCCAGCCTCAATCTCATCTCTCTTTTTGCGTTCTGC
TTCAATATCTGGTTGAACGGCGTCGCGTCGTAACCCAGCTTGGTAAGTTGGATTAAGCAC
TCCGTGGACAGATTTGTCATTGTGAGCATTTTCATCCCGAAGTTGCGGCTCATTCTGATT
CTGAACAGCTTCTTGGGAAGTAGCGACAGCTTGGTTTTTAGTGAGTTGTTCCATTCTTTA
GCTCCTAGACCTTTAGCAGCAAGGTCCATATCTGACTTTTTGTTAACGTATTTAGCCACA
TAGAAACCAACAGCCATATAACTGGTAGCTTTAAGCGGCTCACCTTTAGCATCAACAGGC
CACAACCAACCAGAACGTGAAAAAGCGTCCTGCGTGTAGCGAACTGCGATGGGCATACTG
TAACCATAAGGCCACGTATTTTGCAAGCTATTTAACTGGCGGCGATTGCGTACCCGACGA
CCAAAATTAGGGTCAACGCTACCTGTAGGAAGTGTCCGCATAAAGTGCACCGCATGGAAA
TGAAGACGGCCATTAGCTGTACCATACTCAGGCACACAAAAATACTGATAGCAGTCGGCG
TGTGAATCATTAGCCTTGCGACCCTCGGCAGCAAGAACCATACGACCAATATCACGAAAA
TAGTCACGCAAAGCATTGGGATTATCATAAAACGCCTCTAATCGGTCGTCAGCCAACGTG
AGAGTGTCAAAAACGATAAACCAACCATCAGCATGAGCCTGTCGCATTGCATTCATCAAA
CGCTGAATAGCAAAGCCTCTACGCGATTTCATAGTGGAGGCCTCCAGCAATCTTGAACAC
TCATCCTTAATACCTTTCTTTTTGGGGTAATTATACTCATCGCGAATATCCTTAAGAGGG
CGTTCAGCAGCCAGCTTGCGGCAAAACTGCGTAACCGTCTTCTCGTTCTCTAAAAACCAT
TTTTCGTCCCCTTCGGGGCGGTGGTCTATAGTGTTATTAATATCAAGTTGGGGGAGCACA
TTGTAGCATTGTGCCAATTCATCCATTAACTTCTCAGTAACAGATACAAACTCATCACGA
ACGTCAGAAGCAGCCTTATGGCCGTCAACATACATATCACCATTATCGAACTCAACGCCC
TGCATACGAAAAGACAGAATCTCTTCCAAGAGCTTGATGCGGTTATCCATCTGCTTATGG
AAGCCAAGCATTGGGGATTGAGAAAGAGTAGAAATGCCACAAGCCTCAATAGCAGGTTTA
AGAGCCTCGATACGCTCAAAGTCAAAATAATCAGCGTGACATTCAGAAGGGTAATAAGAA
CGAACCATAAAAAAGCCTCCAAGATTTGGAGGCATGAAAACATACAATTGGGAGGGTGTC
AATCCTGACGGTTATTTCCTAGACAAATTAGAGCCAATACCATCAGCTTTACCGTCTTTC
CAGAAATTGTTCCAAGTATCGGCAACAGCTTTATCAATACCATGAAAAATATCAACCACA
CCAGAAGCAGCATCAGTGACGACATTAGAAATATCCTTTATGAGAAGAGCCAT

Intact (score > 90)

Questionable (score 70-90)

Incomplete (score < 70)

Region:	The number assigned to the region.
Region Length:	The length of the sequence of that region (in bp).
Completeness:	A prediction of whether the region contains a intact or incomplete prophage based on the above criteria.
Score:	The score of the region based on the above criteria.
# Total Proteins:	The number of ORFs present in the region.
Region Position:	The start and end positions of the region on the bacterial chromosome.
Most Common Phage:	The phage(s) with the highest number of proteins most similar to those in the region.
GC %:	The percentage of GC nucleotides of the region.

Criteria for scoring prophage regions (as intact, questionable, or incomplete):
Method 1:

If the number of certain phage organism in this table is more than or equal to 100% of the total number of CDS of the region, the region is marked with total score 150. If less than 100%, method 2 and 3 will be used.

Method 2:

If the number of certain phage organism in this table is more than 50% of the total number of CDS of the region, that phage organism is considered as the major potential phage for that region; the percentage of the total number of that phage organism in this table in the total number of proteins of the region is calculated and then multipled by 100; the percentage of the length of that phage organism in this table in the length of the region is calculated and then multipled by 50 (phage head's encapsulation capability is considered).

Method 3:

If any of the specific phage-related keywords (such as 'capsid', 'head', 'integrase', 'plate', 'tail', 'fiber', 'coat', 'transposase', 'portal', 'terminase', 'protease' or 'lysin') are present, the score will be increased by 10 for each keyword found.
If the size of the region is greater than 30 Kb, the score will be increased by 10.
If there are at least 40 proteins in the region, the score will be increased by 10.
If all of the phage-related proteins and hypothetical proteins constitute more than 70% of the total number of proteins in the region, the score will be increased by 10.

Compared the total score of method 2 with the total score of method 3, the bigger one is chosen as the total score of the region.
If the region's total score is less than 70, it is marked as incomplete; if between 70 to 90, it is marked as questionable; if greater than 90, it is marked as intact.

gi|00000000|ref|CABMJE010000001.1| gi||ref|| Lactobacillus acidophilus isolate MGYG-HGUT-02379 genome assembly, 2009507, gc%: 34.60%

Download details as .txt file:detail.txt

Phage-like protein

Head protein

Replication protein

intact

Region 1, total 7 CDS

#	CDS Position	BLAST Hit	E-Value	Sequence
1	531083..531610	PP_00516;major spike protein;phage;-;PHAGE_Entero_lato_NC_001422	8.01e-127	Show
2	531721..533004	PP_00517;capsid protein;phage;-;PHAGE_Entero_lato_NC_001422	0.0	Show
3	533041..533157	PP_00518;DNA packaging protein;phage;-;PHAGE_Entero_lato_NC_001422	1.04e-18	Show
4	533157..533615	PP_00519;external scaffolding protein;phage;-;PHAGE_Entero_lato_NC_001422	6.11e-109	Show
5	533612..533755	PP_00520;C;phage;-;PHAGE_Entero_lato_NC_001422	1.1e-27	Show
6	533869..535410	PP_00521;DNA replication initiation protein gpA;phage;-;PHAGE_Entero_lato_NC_001422	0.0	Show
7	535474..535635	PP_00522;minor spike protein;phage;-;PHAGE_Entero_lato_NC_001422	8.54e-27	Show

gi|00000000|ref|CABMJE010000001.1| gi||ref|| Lactobacillus acidophilus isolate MGYG-HGUT-02379 genome assembly, 2009507, gc%: 34.60%

Download details as .txt file:detail.txt

Non phage-like protein

tRNA

tmRNA

rRNA

Bacterial, total 1262 CDS

#	CDS Position	BLAST Hit	E-Value	Sequence
1	299..1309	PP_00001; PTS system mannose-specific EIIAB component	1.57e-118	Show
2	1328..2137	PP_00002; PTS system mannose-specific EIIC component	3.13e-70	Show
3	2166..3089	PP_00003; PTS system mannose-specific EIID component	1.23e-96	Show
4	3510..4421	PP_00005; HTH-type transcriptional regulator CysL	5.41e-21	Show
5	4613..5026	PP_00006; Putative acetyltransferase C18B11.09c	2.08e-25	Show
6	5054..6427	PP_00007; Uncharacterized transporter YdgF	1.42e-125	Show
7	6720..9350	PP_00008; Aldehyde-alcohol dehydrogenase 2	3.99e-280	Show
8	9532..11343	PP_00009; Glutamine--fructose-6-phosphate aminotransferase [isomerizing]	3.32e-242	Show
9	11678..12178	PP_00010; Acetate kinase	3.32e-54	Show
10	12254..12871	PP_00011; Acetate kinase	1.57e-68	Show
11	19330..21312	PP_00017; Uncharacterized ATP-dependent helicase YprA	2.78e-21	Show
12	22191..23441	PP_00020; Ammonium transporter	1.69e-95	Show
13	24353..24425	tRNA-Thr	0.0	Show
14	24687..29156	PP_00022; Uncharacterized adenine-specific methylase MPN_108	2.57e-07	Show
15	41117..42454	PP_00040; Lichenan permease IIC component	5.07e-110	Show
16	45624..46205	PP_00044; 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase	2.67e-09	Show
17	46206..46778	PP_00045; 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase 1	5.84e-08	Show
18	47532..47831	PP_00047; Putative glycerophosphodiester phosphodiesterase YhdW	3.04e-16	Show
19	48323..49300	PP_00049; Ribose operon repressor	2.24e-54	Show
20	50815..51699	PP_00051; Arabinooligosaccharides transport system permease protein AraP	2.09e-43	Show
21	51692..52549	PP_00052; Arabinooligosaccharides transport system permease protein AraQ	9.24e-36	Show
22	52549..53841	PP_00053; Beta-fructosidase	3.07e-69	Show
23	53853..54959	PP_00054; Multiple sugar-binding transport ATP-binding protein MsmK	1.37e-177	Show
24	55086..56528	PP_00055; Sucrose phosphorylase	6.91e-237	Show
25	57944..58015	tRNA-Gln	0.0	Show
26	61458..61539	tRNA-Tyr	0.0	Show
27	61574..61645	tRNA-Gln	0.0	Show
28	62997..63698	PP_00060; HTH-type transcriptional repressor NagR	1.39e-38	Show
29	63734..64120	PP_00061; Glycerol-3-phosphate cytidylyltransferase	3.58e-65	Show
30	64250..64978	PP_00062; N-acetylglucosaminyldiphosphoundecaprenol N-acetyl-beta-D-mannosaminyltransferase	4.24e-58	Show
31	64988..66079	PP_00063; D-inositol 3-phosphate glycosyltransferase	7.6e-11	Show
32	66171..67649	PP_00064; Nicotinate phosphoribosyltransferase	1.62e-202	Show
33	67646..68476	PP_00065; NH(3)-dependent NAD(+) synthetase	2.26e-186	Show
34	68668..71340	PP_00066; Calcium-transporting ATPase 1	2.56e-257	Show
35	71431..72585	PP_00067; Teichoic acid glycerol-phosphate primase	6.56e-15	Show
36	74718..75179	PP_00070; Protein SprT-like	5.78e-47	Show
37	75253..75340	tRNA-Leu	0.0	Show
38	75424..76071	PP_00071; Exo-glucosaminidase LytG	2.21e-41	Show
39	76159..78399	PP_00072; ATP-dependent DNA helicase PcrA	3.91e-263	Show
40	78432..80438	PP_00073; DNA ligase	0.0	Show
41	80453..81601	PP_00074; Uncharacterized lipoprotein YerH	3.52e-64	Show
42	81613..81921	PP_00075; Aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C	2.57e-66	Show
43	81921..83360	PP_00076; Glutamyl-tRNA(Gln) amidotransferase subunit A	0.0	Show
44	83365..84795	PP_00077; Aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B	0.0	Show
45	84821..85741	PP_00078; Diacylglycerol kinase	1.5e-94	Show
46	85812..86516	PP_00079; Uncharacterized protein YrjE	3.51e-37	Show
47	87035..88411	PP_00081; Na(+)/H(+) antiporter NhaC	5.38e-104	Show
48	88777..90129	PP_00082; Uncharacterized RNA methyltransferase LJ_1698	6.73e-280	Show
49	91239..93140	PP_00085; Probable cadmium-transporting ATPase	2.02e-105	Show
50	93166..93396	PP_00086; Copper-transporting ATPase 2	2.56e-05	Show
51	93958..94593	PP_00088; Probable transcriptional regulator flp	2.5e-29	Show
52	94675..95262	PP_00089; Uncharacterized protein HI_0220.2	9.5e-83	Show
53	95634..95981	PP_00091; Aspartate racemase	3.2e-07	Show
54	99744..99830	tRNA-Sup	0.0	Show
55	99837..99910	tRNA-Asp	0.0	Show
56	99917..99992	tRNA-His	0.0	Show
57	99997..100069	tRNA-Val	0.0	Show
58	100135..101601	PP_00096; Multidrug resistance protein 3	4.82e-52	Show
59	103032..104804	PP_00099; Oleate hydratase	1.6e-264	Show
60	106071..106907	PP_00101; Glyoxal reductase	7.74e-81	Show
61	107786..108370	PP_00103; Cystic fibrosis transmembrane conductance regulator	8.61e-07	Show
62	108728..110062	PP_00105; Uracil permease	1.15e-143	Show
63	110074..110604	PP_00106; Bifunctional protein PyrR	3.89e-76	Show
64	110806..111318	PP_00107; 5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YbjI	5.93e-30	Show
65	111285..111596	PP_00108; Sugar phosphatase YbiV	1.29e-17	Show
66	111722..113191	PP_00109; Multidrug resistance protein 3	2.55e-52	Show
67	113214..114419	PP_00110; Multidrug resistance protein MdtG	4.5e-118	Show
68	115495..116577	PP_00112; Putative aminopeptidase MJ0555	1.65e-40	Show
69	116671..118296	PP_00113; Uncharacterized ABC transporter ATP-binding protein YkpA	1.95e-245	Show
70	119236..120054	PP_00115; ABC transporter glutamine-binding protein GlnH	1.89e-71	Show
71	120695..122425	PP_00117; Uncharacterized ABC transporter ATP-binding protein YfiB	8.01e-107	Show
72	122425..124194	PP_00118; Uncharacterized ABC transporter ATP-binding protein TM_0288	1.45e-128	Show
73	124985..125614	PP_00120; Uridine kinase	1.17e-139	Show
74	126279..127019	PP_00121; Glutamine transport ATP-binding protein GlnQ	4.32e-108	Show
75	127033..127851	PP_00122; ABC transporter glutamine-binding protein GlnH	4.86e-77	Show
76	127851..128492	PP_00123; Probable glutamine ABC transporter permease protein GlnM	1.86e-68	Show
77	128507..129163	PP_00124; Probable glutamine ABC transporter permease protein GlnP	8.33e-64	Show
78	133113..134036	PP_00129; Bifunctional ribokinase/ribose-5-phosphate isomerase A	3.16e-82	Show
79	134037..134729	PP_00130; Ribose-5-phosphate isomerase A	6.33e-163	Show
80	134881..136896	PP_00131; Probable potassium transport system protein Kup 2	0.0	Show
81	137010..137936	PP_00132; Non-specific ribonucleoside hydrolase RihC	1.39e-77	Show
82	137939..138664	PP_00133; HTH-type transcriptional regulator GmuR	2.65e-32	Show
83	139679..141262	PP_00136; Transport/processing ATP-binding protein ComA	5.26e-22	Show
84	141307..142125	PP_00137; 5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YbjI	2.51e-37	Show
85	142774..144531	PP_00139; Multidrug resistance ABC transporter ATP-binding and permease protein	6.8e-201	Show
86	146056..148455	PP_00142; Probable phosphoketolase 1	0.0	Show
87	153007..153816	PP_00147; Putative phosphatase YxeH	1.03e-42	Show
88	154347..156227	PP_00148; PTS system maltose-specific EIICB component	2.69e-200	Show
89	156289..157101	PP_00149; Uncharacterized HTH-type transcriptional regulator CA_C0191	1.08e-11	Show
90	157603..158088	PP_00151; PTS system glucose-specific EIICBA component	5.78e-41	Show
91	158514..159170	PP_00153; Chloronitrobenzene nitroreductase	3.67e-14	Show
92	159265..160617	PP_00154; UPF0053 protein YqhB	2.42e-65	Show
93	160726..161295	PP_00155; Hypoxanthine-guanine phosphoribosyltransferase	1.28e-59	Show
94	161322..162626	PP_00156; Serine/threonine exchanger SteT	6.72e-95	Show
95	163436..164674	PP_00158; Probable ATP-dependent RNA helicase YfmL	1.61e-61	Show
96	164671..165996	PP_00159; PTS system cellobiose-specific EIIC component	2.38e-93	Show
97	166046..166118	tRNA-Arg	0.0	Show
98	166472..167614	PP_00161; UDP-N-acetylglucosamine 2-epimerase	1.15e-163	Show
99	168144..168590	PP_00163; Probable flavodoxin 2	1.49e-19	Show
100	168734..169561	PP_00164; Methionine aminopeptidase 1	6.75e-72	Show
101	169570..170496	PP_00165; Putative ribonuclease-like protein YfkH	2.97e-22	Show
102	170556..171458	PP_00166; UTP--glucose-1-phosphate uridylyltransferase	2.51e-139	Show
103	171568..172725	PP_00167; Acetyl-CoA acetyltransferase	2.25e-123	Show
104	172725..173936	PP_00168; 3-hydroxy-3-methylglutaryl-coenzyme A reductase	4.42e-62	Show
105	173937..175100	PP_00169; Hydroxymethylglutaryl-CoA synthase	3.92e-112	Show
106	175553..176470	PP_00171; Uncharacterized protein YfhR	6.87e-09	Show
107	176894..178276	PP_00172; Uncharacterized RNA methyltransferase LJ_1606	1.67e-257	Show
108	178402..179214	PP_00173; Regulatory protein RecX	2.98e-102	Show
109	180269..181132	PP_00176; Magnesium and cobalt efflux protein CorC	2.39e-39	Show
110	181132..182703	PP_00177; Peptide chain release factor 3	0.0	Show
111	183220..184122	PP_00179; ATP-dependent Clp protease ATP-binding subunit ClpE	5.66e-131	Show
112	184141..185406	PP_00180; ATP-dependent Clp protease ATP-binding subunit ClpE	8.69e-157	Show
113	185895..186161	PP_00181; Phosphocarrier protein HPr	1.29e-46	Show
114	186161..187894	PP_00182; Phosphoenolpyruvate-protein phosphotransferase	1.13e-276	Show
115	188105..188503	PP_00183; Global transcriptional regulator Spx	1.5e-63	Show
116	188648..189388	PP_00184; Adapter protein MecA	1.51e-34	Show
117	191723..192355	PP_00188; GTP pyrophosphokinase YjbM	4.04e-68	Show
118	192352..193155	PP_00189; NAD kinase	1.83e-194	Show
119	193148..194050	PP_00190; Uncharacterized RNA pseudouridine synthase YjbO	8.28e-44	Show
120	194157..195932	PP_00191; Oleate hydratase	1.75e-309	Show
121	196744..197772	PP_00193; Uncharacterized protein llmg_2431	1.5e-75	Show
122	197929..200688	PP_00194; Calcium-transporting ATPase	2.25e-168	Show
123	201154..202341	PP_00196; Putative transport protein YubA	4.29e-71	Show
124	202404..202958	PP_00197; Putative RNA (cytidine(34)-2'-O)-methyltransferase	1.42e-123	Show
125	203372..205807	PP_00199; DNA translocase FtsK	1.34e-208	Show
126	207005..208258	PP_00201; Uncharacterized zinc protease YmfH	2.02e-27	Show
127	208263..208991	PP_00202; Nodulation protein G	5.09e-26	Show
128	209059..210183	PP_00203; Uncharacterized membrane protein YmfM	2.5e-17	Show
129	210206..210766	PP_00204; CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	1.34e-48	Show
130	210943..212034	PP_00205; Protein RecA	5.1e-247	Show
131	212152..213783	PP_00206; Ribonuclease Y	1.73e-292	Show
132	213878..215047	PP_00207; Probable undecaprenyl-phosphate N-acetylglucosaminyl 1-phosphate transferase	5.04e-85	Show
133	215073..215735	PP_00208; IMPACT family member YvyE	7.85e-49	Show
134	215778..217061	PP_00209; ComF operon protein 1	2.4e-80	Show
135	217836..218378	PP_00211; Ribosome hibernation promotion factor	4.75e-73	Show
136	218517..220916	PP_00212; Protein translocase subunit SecA	0.0	Show
137	221093..222091	PP_00213; Peptide chain release factor 2	3.47e-147	Show
138	222390..223358	PP_00215; HPr kinase/phosphorylase	6.82e-229	Show
139	223351..224190	PP_00216; Phosphatidylglycerol--prolipoprotein diacylglyceryl transferase	2.94e-204	Show
140	224230..225249	PP_00217; Glycerol-3-phosphate dehydrogenase [NAD(P)+]	8.11e-241	Show
141	225326..226252	PP_00218; Thioredoxin reductase	4.52e-122	Show
142	226430..228346	PP_00219; 1,4-alpha-glucan branching enzyme GlgB	0.0	Show
143	228362..228937	PP_00220; Glucose-1-phosphate adenylyltransferase	5.06e-136	Show
144	228962..229507	PP_00221; Glucose-1-phosphate adenylyltransferase	3.11e-127	Show
145	229497..230639	PP_00222; Glycogen biosynthesis protein GlgD	1.83e-35	Show
146	230649..232079	PP_00223; Glycogen synthase	0.0	Show
147	232098..234509	PP_00224; Glycogen phosphorylase	7.82e-245	Show
148	234509..236278	PP_00225; Amylopullulanase	7.59e-84	Show
149	236397..238121	PP_00226; Phosphoglucomutase	5.04e-153	Show
150	238224..240275	PP_00227; UvrABC system protein B	0.0	Show
151	240262..243102	PP_00228; UvrABC system protein A	0.0	Show
152	243789..244670	PP_00230; Nucleotide-binding protein LBA0691	2.0e-211	Show
153	244680..245723	PP_00231; Putative gluconeogenesis factor	3.7e-114	Show
154	245716..246651	PP_00232; Probable cell division protein WhiA	3.2e-217	Show
155	246691..247278	PP_00233; ATP-dependent Clp protease proteolytic subunit	1.07e-130	Show
156	249158..250594	PP_00235; Inner membrane transporter YcaM	3.42e-131	Show
157	250895..250966	tRNA-Arg	0.0	Show
158	251208..252239	PP_00236; Central glycolytic genes regulator	9.49e-77	Show
159	252293..253309	PP_00237; Glyceraldehyde-3-phosphate dehydrogenase	5.2e-216	Show
160	253423..254634	PP_00238; Phosphoglycerate kinase	8.15e-287	Show
161	254660..255418	PP_00239; Triosephosphate isomerase	8.05e-186	Show
162	256270..257145	PP_00241; Phosphatase YwpJ	3.4e-44	Show
163	257213..257911	PP_00242; Uracil-DNA glycosylase	5.69e-176	Show
164	257923..258912	PP_00243; Phosphate acetyltransferase	1.45e-120	Show
165	258912..259391	PP_00244; tRNA threonylcarbamoyladenosine biosynthesis protein TsaE	4.99e-31	Show
166	260095..260991	PP_00246; UDP-N-acetylenolpyruvoylglucosamine reductase	1.46e-211	Show
167	261050..262147	PP_00247; Spermidine/putrescine import ATP-binding protein PotA	1.45e-263	Show
168	262137..262949	PP_00248; Putrescine transport system permease protein PotH	2.84e-35	Show
169	262946..263761	PP_00249; Spermidine/putrescine transport system permease protein PotB	2.07e-05	Show
170	263758..264831	PP_00250; Putrescine-binding periplasmic protein SpuD	9.48e-55	Show
171	264868..265710	PP_00251; Diadenylate cyclase	1.44e-93	Show
172	266698..268056	PP_00253; Phosphoglucosamine mutase	0.0	Show
173	268156..268971	PP_00254; Putative phosphatase YxeH	1.43e-39	Show
174	269005..269790	PP_00255; Sugar phosphatase YidA	4.47e-42	Show
175	270604..271062	PP_00257; Low molecular weight phosphotyrosine protein phosphatase	8.92e-30	Show
176	271086..272222	PP_00258; Glycerate kinase	2.19e-121	Show
177	272452..273294	PP_00259; Transcription antiterminator LicT	1.29e-45	Show
178	273419..275410	PP_00260; PTS system beta-glucoside-specific EIIBCA component	1.43e-198	Show
179	275492..276967	PP_00261; 6-phospho-beta-glucosidase	3.53e-162	Show
180	278098..279723	PP_00263; Inner membrane transporter YcaM	3.72e-116	Show
181	280098..280283	PP_00265; 30S ribosomal protein S14 type Z	2.13e-33	Show
182	281053..281781	PP_00267; Probable transcriptional regulatory protein LBA0733	2.67e-170	Show
183	281907..282881	PP_00268; ComG operon protein 1	8.27e-54	Show
184	283864..284223	PP_00270; Type II secretion system core protein G	4.37e-08	Show
185	285580..286581	PP_00274; Uncharacterized protein YtxK	2.86e-45	Show
186	286622..287806	PP_00275; Acetate kinase	1.74e-148	Show
187	287857..288222	tmRNA,Resume consensus sequence (at 85): tataactgcaaataacaa	0.0	Show
188	289419..290324	PP_00277; Protein MalY	6.1e-59	Show
189	290569..291534	PP_00279; Mannose-6-phosphate isomerase	8.62e-101	Show
190	291961..292380	PP_00281; Uncharacterized transcriptional regulatory protein YclJ	1.89e-34	Show
191	292426..292683	PP_00282; Uncharacterized transcriptional regulatory protein YclJ	3.76e-34	Show
192	292686..294137	PP_00283; Sensor histidine kinase YclK	9.07e-79	Show
193	295359..297536	PP_00286; Lipoteichoic acid synthase 2	3.59e-169	Show
194	298367..299704	PP_00288; Glucose-6-phosphate isomerase	0.0	Show
195	299818..301206	PP_00289; Lincomycin resistance protein LmrB	8.41e-58	Show
196	301287..302300	PP_00290; N-acetylmuramyl-L-alanine amidase	7.72e-22	Show
197	302384..302455	tRNA-Glu	0.0	Show
198	302461..302533	tRNA-Gln	0.0	Show
199	308603..309760	PP_00299; Tyrosine recombinase XerC-like	2.46e-26	Show
200	309931..311283	PP_00300; Lipid II isoglutaminyl synthase (glutamine-hydrolyzing) subunit MurT	4.35e-141	Show
201	311431..312030	PP_00301; Thymidine kinase	1.21e-147	Show
202	312046..313131	PP_00302; Peptide chain release factor 1	2.26e-233	Show
203	313124..313966	PP_00303; Release factor glutamine methyltransferase	1.91e-45	Show
204	313963..314967	PP_00304; Threonylcarbamoyl-AMP synthase	1.69e-83	Show
205	315054..315683	PP_00305; Uracil phosphoribosyltransferase	2.6e-147	Show
206	315806..316519	PP_00306; ATP synthase subunit a	9.4e-72	Show
207	316540..316773	PP_00307; ATP synthase subunit c	2.94e-38	Show
208	316830..317339	PP_00308; ATP synthase subunit b	9.97e-96	Show
209	317339..317887	PP_00309; ATP synthase subunit delta	1.95e-122	Show
210	317902..319413	PP_00310; ATP synthase subunit alpha	0.0	Show
211	319424..320386	PP_00311; ATP synthase gamma chain	2.85e-220	Show
212	320409..321848	PP_00312; ATP synthase subunit beta	0.0	Show
213	321860..322300	PP_00313; ATP synthase epsilon chain	7.0e-94	Show
214	322684..323673	PP_00315; Cell shape-determining protein Mbl	5.15e-145	Show
215	323687..323980	PP_00316; Putative membrane protein insertion efficiency factor	7.02e-64	Show
216	324238..325431	PP_00318; Peptidoglycan glycosyltransferase RodA	1.97e-63	Show
217	325498..325962	PP_00319; Putative universal stress protein SH1215	1.55e-40	Show
218	326604..327923	PP_00321; Uncharacterized AAA domain-containing protein YrvN	5.52e-175	Show
219	328484..329095	PP_00323; 30S ribosomal protein S4	2.15e-143	Show
220	329377..331089	PP_00324; Septation ring formation regulator EzrA	8.22e-69	Show
221	331177..332337	PP_00325; NifS/IcsS protein homolog	6.53e-213	Show
222	332337..333554	PP_00326; Probable tRNA sulfurtransferase	4.41e-292	Show
223	333601..334311	PP_00327; Uncharacterized RNA pseudouridine synthase YtzG	3.05e-63	Show
224	335611..338250	PP_00328; Valine--tRNA ligase	0.0	Show
225	338251..339522	PP_00329; Folylpolyglutamate synthase	8.83e-60	Show
226	339512..340189	PP_00330; Phosphorylated carbohydrates phosphatase TM_1254	9.24e-19	Show
227	340226..340849	PP_00331; UPF0758 protein EF_2926	3.04e-33	Show
228	340945..341949	PP_00332; Cell shape-determining protein MreB	7.59e-147	Show
229	341995..342846	PP_00333; Cell shape-determining protein MreC	9.83e-51	Show
230	344148..344579	PP_00337; Transcriptional regulator MraZ	8.56e-89	Show
231	344588..345535	PP_00338; Ribosomal RNA small subunit methyltransferase H	6.29e-226	Show
232	345911..348073	PP_00340; Penicillin-binding protein 2B	2.91e-150	Show
233	348080..349048	PP_00341; Phospho-N-acetylmuramoyl-pentapeptide-transferase	2.9e-230	Show
234	349052..350431	PP_00342; UDP-N-acetylmuramoylalanine--D-glutamate ligase	0.0	Show
235	350434..351540	PP_00343; UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase	6.68e-266	Show
236	351558..352415	PP_00344; Cell division protein DivIB	9.05e-98	Show
237	352476..353828	PP_00345; Cell division protein FtsA	5.47e-90	Show
238	353843..355201	PP_00346; Cell division protein FtsZ	4.74e-229	Show
239	355220..355657	PP_00347; Cell division protein SepF	2.87e-97	Show
240	356735..357538	PP_00350; Cell cycle protein GpsB	1.08e-05	Show
241	357761..360544	PP_00351; Isoleucine--tRNA ligase	0.0	Show
242	360544..360747	PP_00352; Cold shock-like protein CspD	2.38e-09	Show
243	360766..361335	PP_00353; ADP-ribose pyrophosphatase	4.18e-41	Show
244	361671..362366	PP_00355; 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase	1.26e-41	Show
245	362855..363982	PP_00357; tRNA-specific 2-thiouridylase MnmA	8.02e-282	Show
246	364072..364731	PP_00358; Probable phosphoglycerate mutase GpmB	4.22e-13	Show
247	365375..367729	PP_00360; ATP-dependent RecD-like DNA helicase	3.89e-164	Show
248	369502..370449	PP_00362; Putative lipid kinase YtlR	1.29e-26	Show
249	370502..372181	PP_00363; Ribonuclease J 1	1.73e-241	Show
250	372188..372409	PP_00364; DNA-directed RNA polymerase subunit epsilon	8.98e-47	Show
251	372752..373306	PP_00365; Peptide deformylase	2.65e-121	Show
252	373560..375404	PP_00366; 50S ribosomal subunit assembly factor BipA	2.44e-285	Show
253	375457..376689	PP_00367; Probable peptidoglycan glycosyltransferase FtsW	4.51e-66	Show
254	377027..377578	PP_00369; Putative rRNA methyltransferase YlbH	7.02e-35	Show
255	377578..378063	PP_00370; Phosphopantetheine adenylyltransferase	2.02e-107	Show
256	378056..379096	PP_00371; Uncharacterized protein YlbL	1.5e-67	Show
257	379152..379835	PP_00372; ComE operon protein 1	5.0e-34	Show
258	379804..382092	PP_00373; ComE operon protein 3	1.77e-66	Show
259	382089..383078	PP_00374; Uncharacterized protein YqeN	9.27e-33	Show
260	383139..383396	PP_00375; 30S ribosomal protein S20	1.54e-48	Show
261	383597..383866	PP_00376; 30S ribosomal protein S15	2.38e-56	Show
262	384008..385765	PP_00377; Ribonuclease J 2	1.65e-197	Show
263	386791..387981	PP_00379; Elongation factor Tu	2.84e-288	Show
264	388127..389455	PP_00380; Trigger factor	2.36e-292	Show
265	389582..390844	PP_00381; ATP-dependent Clp protease ATP-binding subunit ClpX	2.34e-275	Show
266	390834..391424	PP_00382; Probable GTP-binding protein EngB	8.17e-140	Show
267	391456..392460	PP_00383; Diaminopimelate epimerase	5.31e-105	Show
268	392472..393827	PP_00384; Aspartokinase 3	3.92e-128	Show
269	394306..395613	PP_00385; Diaminopimelate decarboxylase	3.4e-172	Show
270	395634..396344	PP_00386; 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase	2.77e-107	Show
271	396347..397498	PP_00387; N-acetyldiaminopimelate deacetylase	6.37e-283	Show
272	397504..398439	PP_00388; 4-hydroxy-tetrahydrodipicolinate synthase	6.28e-224	Show
273	398432..399211	PP_00389; 4-hydroxy-tetrahydrodipicolinate reductase	1.22e-184	Show
274	399227..400402	PP_00390; Probable N-acetyl-LL-diaminopimelate aminotransferase	4.96e-103	Show
275	400402..401460	PP_00391; Aspartate-semialdehyde dehydrogenase	2.45e-138	Show
276	401551..402660	PP_00392; Penicillin-binding protein 4*	1.09e-06	Show
277	404652..404921	PP_00394; Urocanate reductase	6.99e-07	Show
278	407069..407755	PP_00397; Pyrimidine-specific ribonucleoside hydrolase RihA	8.6e-14	Show
279	410756..412093	PP_00404; PTS system oligo-beta-mannoside-specific EIIC component	2.03e-70	Show
280	412093..413475	PP_00405; Aryl-phospho-beta-D-glucosidase BglA	7.61e-106	Show
281	413661..414524	PP_00406; Uncharacterized protein CPE0188	3.58e-41	Show
282	415874..417160	PP_00409; Enolase	1.22e-312	Show
283	417386..418219	PP_00410; DegV domain-containing protein SPy_1698/M5005_Spy1391	7.79e-57	Show
284	418950..419927	PP_00412; Conjugated bile acid hydrolase	1.21e-118	Show
285	420062..420150	tRNA-Ser	0.0	Show
286	423863..425254	PP_00419; Probable threonine/serine transporter YbxG	3.46e-165	Show
287	425382..426338	PP_00420; Thymidylate synthase	8.47e-246	Show
288	426348..426851	PP_00421; Dihydrofolate reductase	3.81e-28	Show
289	426930..429350	PP_00422; Probable cation-transporting ATPase exp7	2.17e-146	Show
290	429722..430576	PP_00423; Probable D-methionine-binding lipoprotein MetQ	8.22e-48	Show
291	430591..431652	PP_00424; Methionine import ATP-binding protein MetN	1.02e-241	Show
292	431645..432346	PP_00425; Methionine import system permease protein MetP	7.98e-32	Show
293	432546..433949	PP_00426; Fumarate hydratase class II	1.29e-153	Show
294	433963..435345	PP_00427; NADH:fumarate oxidoreductase	6.57e-125	Show
295	437114..438040	PP_00429; L-lactate dehydrogenase 2	2.54e-217	Show
296	438169..439482	PP_00430; Aminopeptidase E	9.11e-204	Show
297	439734..441200	PP_00431; Putative malate transporter YflS	6.95e-123	Show
298	441277..442068	PP_00432; Putative non-heme chloroperoxidase	4.92e-12	Show
299	442158..443213	PP_00433; [Citrate [pro-3S]-lyase] ligase	2.83e-74	Show
300	443203..443496	PP_00434; Citrate lyase acyl carrier protein	1.12e-60	Show
301	443496..444410	PP_00435; Citrate lyase subunit beta	1.32e-138	Show
302	444400..445941	PP_00436; Citrate lyase alpha chain	4.84e-265	Show
303	446184..446639	PP_00437; UPF0756 membrane protein LBA0919	6.39e-97	Show
304	447678..449378	PP_00440; Putative ABC transporter ATP-binding protein LJ_1704	1.92e-300	Show
305	449390..449947	PP_00441; UPF0397 protein LBA0922	1.08e-125	Show
306	453592..454101	PP_00446; Putative Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase EbsC	1.41e-34	Show
307	454162..455106	PP_00447; Ribosomal protein L11 methyltransferase	3.23e-223	Show
308	455539..457779	PP_00449; GTP pyrophosphokinase	1.05e-275	Show
309	457779..458216	PP_00450; D-aminoacyl-tRNA deacylase	7.33e-100	Show
310	458508..459794	PP_00451; Histidine--tRNA ligase	2.36e-310	Show
311	459802..461646	PP_00452; Aspartate--tRNA ligase	0.0	Show
312	461712..462896	PP_00453; Putative aminotransferase YugH	1.09e-83	Show
313	463053..464246	PP_00454; Coenzyme A biosynthesis bifunctional protein CoaBC	1.69e-97	Show
314	464577..465392	PP_00455; Uncharacterized oxidoreductase MSMEG_2408/MSMEI_2347	6.23e-56	Show
315	465444..466256	PP_00456; Sugar phosphatase YidA	2.02e-61	Show
316	466323..467288	PP_00457; Glyoxylate reductase	2.78e-76	Show
317	467323..468708	PP_00458; Methylthioribose transporter	3.96e-135	Show
318	468805..469419	PP_00459; Alkaline phosphatase-like protein	3.84e-65	Show
319	469555..471357	PP_00460; UvrABC system protein C	0.0	Show
320	471436..472737	PP_00461; GTPase Obg	1.17e-308	Show
321	472758..474125	PP_00462; Putative peptidoglycan O-acetyltransferase YrhL	3.57e-72	Show
322	474183..474677	PP_00463; Putative O-acetyltransferase SACOL0978	7.77e-22	Show
323	474698..475636	PP_00464; Ribonuclease Z	3.66e-228	Show
324	475633..476427	PP_00465; Uncharacterized oxidoreductase YqjQ	4.23e-70	Show
325	476783..476971	PP_00467; 50S ribosomal protein L32	1.26e-39	Show
326	477029..478585	PP_00468; 2',3'-cyclic-nucleotide 2'-phosphodiesterase/3'-nucleotidase	7.25e-41	Show
327	478982..482089	PP_00470; DNA polymerase III subunit alpha	1.72e-225	Show
328	482256..483218	PP_00471; ATP-dependent 6-phosphofructokinase	1.1e-233	Show
329	483247..485016	PP_00472; Pyruvate kinase	0.0	Show
330	485140..486030	PP_00473; Uncharacterized protein YitL	5.39e-48	Show
331	486020..486925	PP_00474; Tyrosine recombinase XerD	2.97e-98	Show
332	486935..487297	PP_00475; Protein RibT	4.89e-16	Show
333	487284..488024	PP_00476; Segregation and condensation protein A	1.47e-107	Show
334	488014..488607	PP_00477; Segregation and condensation protein B	1.14e-85	Show
335	488607..489323	PP_00478; Ribosomal large subunit pseudouridine synthase B	1.44e-90	Show
336	489547..490095	PP_00479; Riboflavin transporter RibU	1.46e-07	Show
337	490337..490798	PP_00480; N-acetylmuramoyl-L-alanine amidase XlyA	1.32e-05	Show
338	490849..491511	PP_00481; Cytidylate kinase	4.21e-101	Show
339	491596..492807	PP_00482; 30S ribosomal protein S1	8.93e-105	Show
340	492893..494200	PP_00483; GTPase Der	9.37e-316	Show
341	494364..494639	PP_00484; DNA-binding protein HU	2.27e-39	Show
342	496007..496894	PP_00486; UPF0750 membrane protein YpjC	2.3e-66	Show
343	496978..498177	PP_00487; CCA-adding enzyme	2.71e-283	Show
344	498217..498882	PP_00488; Hemolysin-3	4.16e-52	Show
345	499002..499646	PP_00489; DegV domain-containing protein spr1019	5.67e-56	Show
346	499856..500086	PP_00490; UPF0346 protein LBA0976	8.1e-49	Show
347	500131..501732	PP_00491; Sodium, potassium, lithium and rubidium/H(+) antiporter	1.23e-37	Show
348	501766..502620	PP_00492; Ribosome biogenesis GTPase A	3.48e-85	Show
349	502610..503362	PP_00493; Ribonuclease HII	1.09e-173	Show
350	503424..504281	PP_00494; DNA processing protein DprA	6.36e-53	Show
351	504342..506459	PP_00495; DNA topoisomerase 1	5.71e-308	Show
352	506486..507802	PP_00496; Methylenetetrahydrofolate--tRNA-(uracil-5-)-methyltransferase TrmFO	8.35e-316	Show
353	507802..508710	PP_00497; Tyrosine recombinase XerC	7.29e-117	Show
354	508720..509244	PP_00498; ATP-dependent protease subunit HslV	3.77e-94	Show
355	509256..510656	PP_00499; ATP-dependent protease ATPase subunit HslU	4.39e-307	Show
356	512490..513758	PP_00503; PTS system lactose-specific EIICB component	6.96e-17	Show
357	515025..515097	tRNA-Val	0.0	Show
358	515100..515172	tRNA-Lys	0.0	Show
359	515185..515266	tRNA-Leu	0.0	Show
360	515291..515363	tRNA-Thr	0.0	Show
361	515374..515445	tRNA-Gly	0.0	Show
362	515458..515543	tRNA-Leu	0.0	Show
363	515552..515625	tRNA-Arg	0.0	Show
364	515631..515704	tRNA-Pro	0.0	Show
365	515735..515808	tRNA-Met	0.0	Show
366	515821..515894	tRNA-Met	0.0	Show
367	515911..515984	tRNA-Met	0.0	Show
368	515988..516061	tRNA-Asp	0.0	Show
369	516068..516140	tRNA-Phe	0.0	Show
370	516160..516230	tRNA-Gly	0.0	Show
371	516236..516310	tRNA-Ile	0.0	Show
372	516313..516402	tRNA-Ser	0.0	Show
373	516573..516995	PP_00505; 8-oxo-dGTP diphosphatase	4.16e-11	Show
374	516995..519589	PP_00506; Type I restriction enzyme EcoEI endonuclease subunit	1.86e-18	Show
375	520097..520168	tRNA-Glu	0.0	Show
376	520206..520292	tRNA-Ser	0.0	Show
377	520302..520375	tRNA-Met	0.0	Show
378	520379..520452	tRNA-Asp	0.0	Show
379	520459..520534	tRNA-Phe	0.0	Show
380	520539..520620	tRNA-Tyr	0.0	Show
381	520625..520695	tRNA-Trp	0.0	Show
382	520708..520783	tRNA-His	0.0	Show
383	520788..520859	tRNA-Gln	0.0	Show
384	520883..520953	tRNA-Cys	0.0	Show
385	520991..521075	tRNA-Leu	0.0	Show
386	521193..522356	PP_00508; Alpha-monoglucosyldiacylglycerol synthase	2.19e-112	Show
387	522371..523414	PP_00509; Alpha-galactosylglucosyldiacylglycerol synthase	1.89e-115	Show
388	524511..526571	PP_00511; Lipoteichoic acid synthase 1	5.89e-202	Show
389	526943..529291	PP_00513; Ribonuclease R 1	6.46e-210	Show
390	529303..529758	PP_00514; SsrA-binding protein	2.82e-100	Show
391	530250..531074	PP_00515; Minor spike protein H	1.27e-146	Show
392	536698..537087	PP_00524; Putative fluoride ion transporter CrcB 1	1.81e-90	Show
393	537089..537463	PP_00525; Putative fluoride ion transporter CrcB 2	4.53e-84	Show
394	537508..538911	PP_00526; Beta-Ala-Xaa dipeptidase	1.63e-257	Show
395	539031..540503	PP_00527; Aspartate/glutamate permease AcaP	1.08e-107	Show
396	540741..542834	PP_00528; Inducible ornithine decarboxylase	4.17e-207	Show
397	542861..544123	PP_00529; Uncharacterized protein YnbB	3.52e-136	Show
398	544560..545231	PP_00530; Ktr system potassium uptake protein C	1.18e-52	Show
399	545224..546564	PP_00531; Potassium/sodium uptake protein NtpJ	2.36e-119	Show
400	546725..548497	PP_00532; Probable ATP-dependent DNA helicase RecQ	7.94e-170	Show
401	549107..551629	PP_00534; UvrABC system protein A	1.21e-179	Show
402	551702..552634	PP_00535; Homocysteine S-methyltransferase YbgG	3.93e-69	Show
403	559836..561767	PP_00543; PTS system beta-glucoside-specific EIIBCA component	3.32e-81	Show
404	561950..562675	PP_00544; HTH-type transcriptional regulator TreR	9.91e-55	Show
405	562686..564350	PP_00545; Trehalose-6-phosphate hydrolase	8.61e-189	Show
406	587529..588986	PP_00553; PTS system sucrose-specific EIIBC component	9.23e-96	Show
407	588999..590537	PP_00554; Sucrose-6-phosphate hydrolase	2.47e-104	Show
408	590543..592762	PP_00555; Alpha-galactosidase AgaA	4.74e-189	Show
409	597570..599405	PP_00560; Uncharacterized protein YPL245W	1.03e-38	Show
410	599969..601156	PP_00562; Putative amidohydrolase YhaA	4.29e-89	Show
411	602147..603250	PP_00564; Peptidoglycan endopeptidase RipA	1.57e-09	Show
412	614888..615703	PP_00566; Putative phosphatase YxeH	7.68e-35	Show
413	617235..618770	PP_00568; Uncharacterized protein HI_0594	8.59e-127	Show
414	619640..619915	PP_00571; Aldo-keto reductase MYCFIDRAFT_87468	7.85e-22	Show
415	619943..620398	PP_00572; Putative aryl-alcohol dehydrogenase C977.14c	5.63e-27	Show
416	620945..621478	PP_00574; Hypoxanthine-guanine phosphoribosyltransferase	1.02e-55	Show
417	623144..625336	PP_00576; Polyphosphate kinase	1.69e-303	Show
418	626719..627459	PP_00578; Exopolyphosphatase	4.18e-18	Show
419	627819..628646	PP_00579; Uncharacterized protein PA2218	8.5e-69	Show
420	630056..631447	PP_00583; Lincomycin resistance protein LmrB	1.49e-47	Show
421	632922..633716	PP_00586; Uncharacterized HTH-type transcriptional regulator YdfL	4.14e-11	Show
422	634727..635365	PP_00588; UPF0659 protein C216.03	8.48e-15	Show
423	635424..636290	PP_00589; Uncharacterized HTH-type transcriptional regulator YbhD	1.45e-10	Show
424	636403..637263	PP_00590; Glyoxal reductase	3.36e-71	Show
425	637284..638153	PP_00591; 2,5-diketo-D-gluconic acid reductase A	2.55e-71	Show
426	638404..639261	PP_00592; Glyoxal reductase	3.57e-91	Show
427	640897..641430	PP_00594; Streptothricin acetyltransferase A	5.43e-27	Show
428	643429..643890	PP_00598; Putative HTH-type transcriptional regulator slr0846	2.52e-06	Show
429	644798..646168	PP_00599; Branched-chain amino acid permease BrnQ	1.03e-125	Show
430	646311..647177	PP_00600; Glyoxal reductase	2.21e-55	Show
431	649631..650290	PP_00603; Glutamine transport system permease protein GlnP	1.17e-29	Show
432	650271..650945	PP_00604; Probable amino-acid permease protein YxeN	3.88e-19	Show
433	650954..651694	PP_00605; Glutamate transport ATP-binding protein GluA	2.49e-78	Show
434	651708..652568	PP_00606; Probable histidine-binding protein	1.01e-11	Show
435	652852..653346	PP_00607; Thiol peroxidase	7.67e-39	Show
436	653528..654130	PP_00608; Probable phosphoglycerate mutase GpmB	3.38e-09	Show
437	654143..655057	PP_00609; 2-keto-4-carboxy-3-hexenedioate hydratase	9.12e-09	Show
438	657621..658814	PP_00614; Uncharacterized MFS-type transporter YdeR	2.49e-51	Show
439	658914..659750	PP_00615; HTH-type transcriptional regulator YofA	1.7e-11	Show
440	659801..660424	PP_00616; Putative ADP-ribose pyrophosphatase YjhB	9.98e-47	Show
441	665803..666399	PP_00625; Phosphoserine phosphatase 1	2.39e-10	Show
442	668015..668617	PP_00628; D-ribitol-5-phosphate phosphatase	4.19e-09	Show
443	673858..675483	PP_00634; Malolactic enzyme	1.6e-260	Show
444	676241..677530	PP_00636; Uncharacterized AAA domain-containing protein YrvN	8.21e-84	Show
445	677614..678591	PP_00637; Conjugated bile acid hydrolase	1.37e-97	Show
446	678937..679545	PP_00638; Putative L,D-transpeptidase YciB	1.01e-16	Show
447	679965..681083	PP_00639; Uncharacterized protein YxjH	1.52e-95	Show
448	681273..681746	PP_00640; S-ribosylhomocysteine lyase	6.1e-116	Show
449	684242..685567	PP_00644; Serine/threonine exchanger SteT	6.16e-139	Show
450	686107..686694	PP_00645; Cysteine synthase	1.06e-59	Show
451	687220..687477	PP_00646; Cystathionine gamma-lyase	5.25e-23	Show
452	687559..688365	PP_00647; Cystathionine beta-lyase	7.45e-108	Show
453	688934..691468	PP_00648; Phosphoenolpyruvate carboxylase	0.0	Show
454	699613..700401	PP_00653; Glucose 1-dehydrogenase	4.69e-116	Show
455	700672..700983	PP_00654; Putative phosphinothricin acetyltransferase YwnH	2.65e-24	Show
456	701175..701798	PP_00655; Probable aldo-keto reductase 1	2.96e-44	Show
457	701814..702173	PP_00656; Aldo-keto reductase str7	4.21e-16	Show
458	702492..703334	PP_00657; Putative sugar uptake protein	2.08e-114	Show
459	705353..706684	PP_00662; Glutathione reductase	1.44e-57	Show
460	711014..712384	PP_00670; Uncharacterized transporter MT2031	1.11e-28	Show
461	712789..713064	PP_00672; Pyrroline-5-carboxylate reductase	1.41e-19	Show
462	714200..715228	PP_00675; UPF0324 membrane protein LJ_1117	1.72e-177	Show
463	716249..716884	PP_00677; Glycerol-3-phosphate acyltransferase 2	1.05e-140	Show
464	716981..718927	PP_00678; DNA topoisomerase 4 subunit B	0.0	Show
465	718956..721406	PP_00679; DNA topoisomerase 4 subunit A	4.27e-292	Show
466	721543..722514	PP_00680; HTH-type transcriptional activator CmpR	5.2e-19	Show
467	722535..723470	PP_00681; Probable manganese-dependent inorganic pyrophosphatase	8.55e-222	Show
468	723608..724207	PP_00682; Putative peptidyl-prolyl cis-trans isomerase	1.44e-74	Show
469	727985..729568	PP_00687; Protein glycosylation K	6.03e-25	Show
470	729565..731154	PP_00688; Iron-sulfur clusters transporter ABCB7, mitochondrial	1.81e-23	Show
471	733517..733855	PP_00691; FMN-dependent NADH:quinone oxidoreductase 2	2.22e-32	Show
472	737753..738829	PP_00697; Tyrosine recombinase XerS	9.76e-96	Show
473	738887..739768	PP_00698; DegV domain-containing protein lin2658	6.29e-64	Show
474	740499..742190	PP_00700; Rqc2 homolog RqcH	1.93e-132	Show
475	742262..745447	PP_00701; Carbamoyl-phosphate synthase large chain	1.61e-182	Show
476	745451..746506	PP_00702; Carbamoyl-phosphate synthase small chain	3.39e-81	Show
477	746511..747419	PP_00703; Uncharacterized RNA pseudouridine synthase YlyB	3.21e-110	Show
478	747412..747876	PP_00704; Lipoprotein signal peptidase	9.56e-73	Show
479	747887..749563	PP_00705; Formate--tetrahydrofolate ligase 1	0.0	Show
480	751296..752420	PP_00707; Putative RNA methyltransferase YpsC	1.84e-125	Show
481	752885..753298	PP_00708; Cell cycle protein GpsB	2.74e-14	Show
482	753394..753957	PP_00709; UPF0398 protein LBA1157	1.95e-138	Show
483	754026..754661	PP_00710; Holliday junction resolvase RecU	7.76e-152	Show
484	754661..756991	PP_00711; Penicillin-binding protein 1A	1.62e-167	Show
485	757170..757799	PP_00712; Endonuclease III	3.12e-51	Show
486	758527..759825	PP_00714; Asparagine--tRNA ligase	0.0	Show
487	760380..763163	PP_00716; 3'-5' exonuclease DinG	1.03e-89	Show
488	763187..766810	PP_00717; ATP-dependent helicase/nuclease subunit A	0.0	Show
489	766813..770295	PP_00718; ATP-dependent helicase/deoxyribonuclease subunit B	0.0	Show
490	770377..771285	PP_00719; Mevalonate kinase	7.84e-26	Show
491	771291..772253	PP_00720; Diphosphomevalonate decarboxylase	1.3e-40	Show
492	772297..773379	PP_00721; Phosphomevalonate kinase	3.1e-63	Show
493	773392..774411	PP_00722; Isopentenyl-diphosphate delta-isomerase	7.48e-77	Show
494	774463..775302	PP_00723; Uncharacterized HTH-type transcriptional regulator HI_0143	2.28e-32	Show
495	776123..776698	PP_00724; D-xylose 1-dehydrogenase (NADP(+))	1.24e-23	Show
496	777159..778310	PP_00726; Putative cysteine desulfurase IscS 1	1.04e-125	Show
497	778428..779813	PP_00727; Ribosomal RNA small subunit methyltransferase F	9.43e-53	Show
498	781600..782169	PP_00730; Signal peptidase IB	3.68e-35	Show
499	784957..785664	PP_00735; Uncharacterized ABC transporter ATP-binding protein YhcG	1.49e-35	Show
500	785657..786031	PP_00736; Uncharacterized HTH-type transcriptional regulator YhcF	4.31e-23	Show
501	786329..787576	PP_00737; Peptidase T	5.77e-288	Show
502	787603..788400	PP_00738; GTP cyclohydrolase 1 type 2 homolog	8.56e-56	Show
503	788393..789079	PP_00739; tRNA (adenine(22)-N(1))-methyltransferase	6.44e-37	Show
504	790337..791449	PP_00742; RNA polymerase sigma factor SigA	9.86e-195	Show
505	791449..793299	PP_00743; DNA primase	1.72e-133	Show
506	793322..795385	PP_00744; Glycine--tRNA ligase beta subunit	0.0	Show
507	795378..796295	PP_00745; Glycine--tRNA ligase alpha subunit	4.13e-178	Show
508	796554..797306	PP_00746; DNA repair protein RecO	2.19e-173	Show
509	797403..798308	PP_00747; GTPase Era	5.13e-218	Show
510	798310..798834	PP_00748; Endoribonuclease YbeY	2.51e-130	Show
511	798837..799796	PP_00749; PhoH-like protein	1.64e-118	Show
512	799821..800264	PP_00750; Uncharacterized protein YqeY	1.09e-42	Show
513	800530..800706	PP_00751; 30S ribosomal protein S21	5.85e-32	Show
514	800972..801808	PP_00752; Putative pyruvate, phosphate dikinase regulatory protein	7.73e-197	Show
515	802744..803313	PP_00754; Peptide methionine sulfoxide reductase MsrA	3.72e-86	Show
516	803398..804276	PP_00755; UPF0750 membrane protein YitT	6.27e-63	Show
517	805179..806042	PP_00757; Homoserine kinase	1.91e-206	Show
518	806067..807299	PP_00758; Homoserine dehydrogenase	9.7e-106	Show
519	807415..808905	PP_00759; Threonine synthase-like 1	4.64e-89	Show
520	808922..810283	PP_00760; Aspartokinase 3	5.22e-129	Show
521	810655..812280	PP_00761; Dipeptide-binding protein	2.64e-80	Show
522	813399..814013	PP_00763; Putative acetyltransferase YJL218W	1.9e-31	Show
523	817888..819213	PP_00767; Probable pyridine nucleotide-disulfide oxidoreductase RclA	5.61e-143	Show
524	819572..820933	PP_00768; Branched-chain amino acid permease BrnQ	1.43e-135	Show
525	826035..826577	PP_00776; Apo-citrate lyase phosphoribosyl-dephospho-CoA transferase	9.62e-21	Show
526	826610..827461	PP_00777; HTH-type transcriptional regulator BsdA	2.16e-29	Show
527	827589..829862	PP_00778; Putative cation-transporting ATPase MJ1226	6.28e-98	Show
528	830544..832034	PP_00780; Cardiolipin synthase	7.81e-139	Show
529	832153..832299	PP_00781; Serine O-acetyltransferase	3.38e-28	Show
530	832306..832941	PP_00782; Serine O-acetyltransferase	4.36e-154	Show
531	832954..833883	PP_00783; Cysteine synthase	2.12e-138	Show
532	835135..835950	PP_00785; Probable 2-(5''-triphosphoribosyl)-3'-dephosphocoenzyme-A synthase	4.27e-87	Show
533	837166..837693	PP_00788; Adenine phosphoribosyltransferase	4.15e-125	Show
534	837798..840071	PP_00789; Single-stranded-DNA-specific exonuclease RecJ	2.11e-128	Show
535	840193..840882	PP_00790; Sortase A	7.8e-38	Show
536	841055..842893	PP_00791; Elongation factor 4	0.0	Show
537	843029..844183	PP_00792; Chaperone protein DnaJ	1.37e-273	Show
538	844267..846111	PP_00793; Chaperone protein DnaK	0.0	Show
539	846127..846711	PP_00794; Protein GrpE	2.51e-108	Show
540	846724..847773	PP_00795; Heat-inducible transcription repressor HrcA	1.47e-248	Show
541	847873..849285	PP_00796; Uncharacterized ABC transporter ATP-binding protein YfmM	5.5e-31	Show
542	849635..850564	PP_00797; Bifunctional riboflavin kinase/FMN adenylyltransferase	9.08e-97	Show
543	850585..851478	PP_00798; tRNA pseudouridine synthase B	9.92e-214	Show
544	851529..851894	PP_00799; Ribosome-binding factor A	2.27e-78	Show
545	851914..854547	PP_00800; Translation initiation factor IF-2	0.0	Show
546	854552..854863	PP_00801; Probable ribosomal protein in infB 5'region	8.16e-22	Show
547	854866..855162	PP_00802; Uncharacterized protein YlxR	1.61e-20	Show
548	855171..856340	PP_00803; Transcription termination/antitermination protein NusA	2.42e-141	Show
549	856360..856836	PP_00804; Ribosome maturation factor RimP	5.62e-108	Show
550	856939..861252	PP_00805; DNA polymerase III PolC-type	0.0	Show
551	861258..862955	PP_00806; Proline--tRNA ligase	0.0	Show
552	862997..864253	PP_00807; Probable protease eep	1.11e-90	Show
553	864265..865080	PP_00808; Phosphatidate cytidylyltransferase	9.16e-71	Show
554	865082..865816	PP_00809; Isoprenyl transferase	1.05e-177	Show
555	865819..866376	PP_00810; Ribosome-recycling factor	2.94e-114	Show
556	866376..867101	PP_00811; Uridylate kinase	3.37e-168	Show
557	867270..868295	PP_00812; Elongation factor Ts	4.82e-234	Show
558	868335..869111	PP_00813; 30S ribosomal protein S2	8.3e-182	Show
559	869275..870306	PP_00814; Probable RNA methyltransferase YabB	1.55e-46	Show
560	870370..870984	PP_00815; 1-acyl-sn-glycerol-3-phosphate acyltransferase	7.03e-59	Show
561	871086..872267	PP_00816; Cyclopropane mycolic acid synthase MmaA2	2.46e-49	Show
562	872315..874258	PP_00817; Neutral endopeptidase	0.0	Show
563	874345..876138	PP_00818; Putative ABC transporter ATP-binding protein exp8	1.64e-152	Show
564	876131..877819	PP_00819; Multidrug resistance-like ATP-binding protein MdlA	8.26e-148	Show
565	877981..878199	PP_00820; UPF0154 protein LBA1278	2.23e-42	Show
566	878265..878525	PP_00821; UPF0291 protein LBA1279	2.08e-51	Show
567	878674..879300	PP_00822; LexA repressor	1.98e-146	Show
568	881053..881985	PP_00825; Putative glycosyltransferase CsbB	1.6e-77	Show
569	884404..884751	PP_00828; 50S ribosomal protein L19	8.11e-76	Show
570	884885..885610	PP_00829; tRNA (guanine-N(1)-)-methyltransferase	4.1e-164	Show
571	885600..886115	PP_00830; Ribosome maturation factor RimM	4.35e-125	Show
572	886187..886459	PP_00831; 30S ribosomal protein S16	1.17e-61	Show
573	886549..887979	PP_00832; Signal recognition particle protein	4.35e-180	Show
574	887983..888324	PP_00833; UPF0122 protein LAR_1089	5.7e-19	Show
575	888517..889944	PP_00834; Branched-chain amino acid permease BcaP	2.4e-196	Show
576	890481..891902	PP_00836; Probable dipeptidase	3.37e-173	Show
577	891944..893239	PP_00837; Signal recognition particle receptor FtsY	2.32e-124	Show
578	893240..896809	PP_00838; Chromosome partition protein Smc	2.28e-170	Show
579	896822..897508	PP_00839; Ribonuclease 3	1.49e-160	Show
580	898541..900331	PP_00841; DNA polymerase III subunit gamma/tau	1.11e-126	Show
581	900526..901032	PP_00842; tRNA-specific adenosine deaminase	2.8e-51	Show
582	901437..902057	PP_00844; Uncharacterized protein YbxB	5.76e-52	Show
583	902981..903343	PP_00846; 50S ribosomal protein L7/L12	1.87e-72	Show
584	903393..903905	PP_00847; 50S ribosomal protein L10	4.32e-111	Show
585	904586..905767	PP_00849; Uncharacterized transporter YfdV	3.13e-90	Show
586	905950..906627	PP_00850; Phosphate-specific transport system accessory protein PhoU homolog	8.84e-22	Show
587	906644..907399	PP_00851; Phosphate import ATP-binding protein PstB 2	1.97e-181	Show
588	907401..908195	PP_00852; Phosphate import ATP-binding protein PstB 1	2.57e-186	Show
589	908204..909091	PP_00853; Probable ABC transporter permease protein YqgI	1.39e-107	Show
590	909094..910089	PP_00854; Probable ABC transporter permease protein YqgH	4.05e-73	Show
591	910093..910959	PP_00855; Phosphate-binding protein PstS 1	2.75e-94	Show
592	911063..911755	PP_00856; 50S ribosomal protein L1	3.66e-162	Show
593	911835..912260	PP_00857; 50S ribosomal protein L11	7.08e-89	Show
594	912387..912944	PP_00858; Transcription termination/antitermination protein NusG	3.56e-68	Show
595	913571..915313	PP_00860; 1-deoxy-D-xylulose-5-phosphate synthase	5.03e-117	Show
596	916314..917798	PP_00862; Gluconokinase	3.17e-123	Show
597	919540..920292	PP_00866; Putative TrmH family tRNA/rRNA methyltransferase YacO	4.42e-74	Show
598	920279..920722	PP_00867; Mini-ribonuclease 3	8.55e-47	Show
599	920715..922148	PP_00868; Cysteine--tRNA ligase	0.0	Show
600	922246..923745	PP_00869; Glutamate--tRNA ligase	0.0	Show
601	923823..925199	PP_00870; DNA repair protein RadA	4.7e-184	Show
602	925199..925750	PP_00871; Deoxyuridine 5'-triphosphate nucleotidohydrolase	3.42e-41	Show
603	926249..927598	PP_00873; Aminopeptidase C	2.26e-305	Show
604	928689..929366	PP_00875; 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase 2	6.34e-118	Show
605	929559..930458	PP_00877; Zinc transporter ZitB	2.43e-56	Show
606	930520..931200	PP_00878; Probable phosphoglycerate mutase GpmB	1.62e-07	Show
607	932072..932731	PP_00880; Phosphoserine phosphatase	5.9e-06	Show
608	932777..933361	PP_00881; Glutathione-independent glyoxalase DJR-1.1	1.53e-14	Show
609	934633..937440	PP_00885; DNA methyltransferase A	1.21e-148	Show
610	940658..941758	PP_00890; Replication protein	1.07e-26	Show
611	942083..943135	PP_00892; Tyrosine recombinase XerC-like	6.56e-20	Show
612	943205..943600	PP_00893; 30S ribosomal protein S9	7.21e-66	Show
613	943612..944055	PP_00894; 50S ribosomal protein L13	4.57e-104	Show
614	944160..944948	PP_00895; tRNA pseudouridine synthase A	5.9e-193	Show
615	944951..945748	PP_00896; Energy-coupling factor transporter transmembrane protein EcfT	1.9e-166	Show
616	945741..946598	PP_00897; Energy-coupling factor transporter ATP-binding protein EcfA2	3.31e-206	Show
617	946574..947425	PP_00898; Energy-coupling factor transporter ATP-binding protein EcfA1	1.19e-198	Show
618	947618..948001	PP_00899; 50S ribosomal protein L17	2.22e-81	Show
619	948026..948964	PP_00900; DNA-directed RNA polymerase subunit alpha	5.98e-218	Show
620	949013..949402	PP_00901; 30S ribosomal protein S11	7.94e-83	Show
621	949427..949777	PP_00902; 30S ribosomal protein S13	5.06e-75	Show
622	949802..949918	PP_00903; 50S ribosomal protein L36	2.29e-23	Show
623	949935..950156	PP_00904; Translation initiation factor IF-1	3.13e-47	Show
624	950228..950884	PP_00905; Adenylate kinase	8.69e-155	Show
625	950896..952191	PP_00906; Protein translocase subunit SecY 1	3.99e-299	Show
626	952191..952631	PP_00907; 50S ribosomal protein L15	2.01e-93	Show
627	952655..952840	PP_00908; 50S ribosomal protein L30	7.7e-36	Show
628	952858..953364	PP_00909; 30S ribosomal protein S5	8.76e-110	Show
629	953382..953738	PP_00910; 50S ribosomal protein L18	2.39e-74	Show
630	953765..954295	PP_00911; 50S ribosomal protein L6	8.69e-123	Show
631	954320..954718	PP_00912; 30S ribosomal protein S8	2.27e-90	Show
632	954744..954929	PP_00913; 30S ribosomal protein S14 type Z	2.37e-39	Show
633	954942..955484	PP_00914; 50S ribosomal protein L5	8.64e-125	Show
634	955499..955732	PP_00915; 50S ribosomal protein L24	1.98e-45	Show
635	955752..956120	PP_00916; 50S ribosomal protein L14	8.86e-81	Show
636	956152..956418	PP_00917; 30S ribosomal protein S17	5.23e-55	Show
637	956437..956634	PP_00918; 50S ribosomal protein L29	1.01e-35	Show
638	956624..957064	PP_00919; 50S ribosomal protein L16	1.66e-101	Show
639	957064..957738	PP_00920; 30S ribosomal protein S3	1.44e-156	Show
640	957752..958105	PP_00921; 50S ribosomal protein L22	1.28e-73	Show
641	958124..958408	PP_00922; 30S ribosomal protein S19	2.3e-63	Show
642	958427..959263	PP_00923; 50S ribosomal protein L2	1.15e-198	Show
643	959279..959581	PP_00924; 50S ribosomal protein L23	3.56e-63	Show
644	959581..960198	PP_00925; 50S ribosomal protein L4	1.34e-138	Show
645	960213..960851	PP_00926; 50S ribosomal protein L3	2.69e-146	Show
646	960875..961183	PP_00927; 30S ribosomal protein S10	7.67e-68	Show
647	961503..963596	PP_00928; Elongation factor G	0.0	Show
648	963630..964100	PP_00929; 30S ribosomal protein S7	6.59e-106	Show
649	964116..964523	PP_00930; 30S ribosomal protein S12	1.71e-91	Show
650	964696..965385	PP_00931; Prepilin peptidase PppA	5.5e-08	Show
651	965436..969089	PP_00932; DNA-directed RNA polymerase subunit beta'	0.0	Show
652	969105..972746	PP_00933; DNA-directed RNA polymerase subunit beta	0.0	Show
653	972967..975444	PP_00934; Chaperone protein ClpB	2.81e-277	Show
654	975549..976004	PP_00935; Protein YtsP	1.31e-45	Show
655	976078..976151	tRNA-Pro	0.0	Show
656	976186..976260	tRNA-Gly	0.0	Show
657	976401..977951	PP_00936; Lysine--tRNA ligase	5.0e-260	Show
658	977967..978992	PP_00937; Probable tRNA-dihydrouridine synthase 1	8.77e-130	Show
659	979072..979962	PP_00938; 33 kDa chaperonin	2.74e-215	Show
660	980020..982176	PP_00939; ATP-dependent zinc metalloprotease FtsH	2.07e-288	Show
661	982272..983528	PP_00940; tRNA(Ile)-lysidine synthase	2.65e-111	Show
662	984395..984637	PP_00943; Uncharacterized protein SP_0007	2.49e-26	Show
663	984654..988151	PP_00944; Transcription-repair-coupling factor	0.0	Show
664	988153..988710	PP_00945; Peptidyl-tRNA hydrolase	3.25e-136	Show
665	988845..989816	PP_00946; L-lactate dehydrogenase 1	1.39e-233	Show
666	990760..991890	PP_00948; Alanine racemase	1.13e-277	Show
667	991890..992246	PP_00949; Holo-[acyl-carrier-protein] synthase	8.0e-82	Show
668	992322..993809	PP_00950; ATP-dependent RNA helicase CshA	1.1e-212	Show
669	993823..995190	PP_00951; UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase	9.17e-112	Show
670	995317..995562	PP_00952; 50S ribosomal protein L31 type B	3.7e-54	Show
671	995672..997291	PP_00953; Glucan 1,6-alpha-glucosidase	4.57e-247	Show
672	997409..998239	PP_00954; 5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YbjI	7.79e-32	Show
673	998280..999872	PP_00955; Glutamate/serine transporter AimA	7.6e-173	Show
674	1001236..1002243	PP_00958; HTH-type transcriptional regulator LacR	2.78e-191	Show
675	1002469..1004355	PP_00959; Beta-galactosidase large subunit	0.0	Show
676	1004339..1005289	PP_00960; Beta-galactosidase small subunit	6.67e-242	Show
677	1005371..1006363	PP_00961; UDP-glucose 4-epimerase	3.54e-235	Show
678	1009419..1010378	PP_00964; Ribose operon repressor	4.99e-40	Show
679	1010356..1013145	PP_00965; Alpha-L-rhamnosidase	1.0e-129	Show
680	1017395..1018372	PP_00971; Bacteriocin helveticin-J	2.18e-47	Show
681	1018825..1019706	PP_00973; Stomatin-like protein 3	5.68e-10	Show
682	1020714..1022375	PP_00975; Formate--tetrahydrofolate ligase 2	0.0	Show
683	1022393..1022878	PP_00976; N5-carboxyaminoimidazole ribonucleotide mutase	2.81e-59	Show
684	1022871..1024019	PP_00977; N5-carboxyaminoimidazole ribonucleotide synthase	4.23e-112	Show
685	1024224..1024940	PP_00978; Phosphoribosylaminoimidazole-succinocarboxamide synthase	3.21e-98	Show
686	1024941..1025195	PP_00979; Phosphoribosylformylglycinamidine synthase subunit PurS	1.25e-12	Show
687	1025192..1025863	PP_00980; Phosphoribosylformylglycinamidine synthase subunit PurQ	9.44e-166	Show
688	1025860..1028088	PP_00981; Phosphoribosylformylglycinamidine synthase subunit PurL	0.0	Show
689	1028064..1029512	PP_00982; Amidophosphoribosyltransferase	1.15e-193	Show
690	1029515..1030552	PP_00983; Phosphoribosylformylglycinamidine cyclo-ligase	2.03e-253	Show
691	1030562..1031164	PP_00984; Phosphoribosylglycinamide formyltransferase	1.02e-49	Show
692	1031161..1032702	PP_00985; Bifunctional purine biosynthesis protein PurH	0.0	Show
693	1032715..1033986	PP_00986; Phosphoribosylamine--glycine ligase	2.56e-124	Show
694	1036080..1038740	PP_00989; DNA polymerase I	0.0	Show
695	1038749..1039579	PP_00990; Formamidopyrimidine-DNA glycosylase	6.69e-206	Show
696	1039576..1040178	PP_00991; Dephospho-CoA kinase	3.18e-139	Show
697	1040181..1040648	PP_00992; Transcriptional repressor NrdR	9.04e-108	Show
698	1042001..1042909	PP_00994; Primosomal protein DnaI	8.25e-56	Show
699	1043190..1045124	PP_00995; Threonine--tRNA ligase	0.0	Show
700	1045282..1045716	PP_00996; Uncharacterized HTH-type transcriptional regulator SAUSA300_2310	4.47e-12	Show
701	1047090..1047539	PP_00999; Translation initiation factor IF-3	1.56e-76	Show
702	1047561..1047761	PP_01000; 50S ribosomal protein L35	2.86e-40	Show
703	1047803..1048159	PP_01001; 50S ribosomal protein L20	1.5e-77	Show
704	1048209..1049210	PP_01002; Adenosine deaminase	3.59e-86	Show
705	1050676..1051326	PP_01004; Probable phosphatase YqeG	2.75e-28	Show
706	1051319..1052428	PP_01005; Uncharacterized protein YqeH	3.73e-119	Show
707	1052439..1053095	PP_01006; Probable nicotinate-nucleotide adenylyltransferase	4.71e-64	Show
708	1053076..1053675	PP_01007; Bis(5'-nucleosyl)-tetraphosphatase, symmetrical	2.33e-58	Show
709	1053690..1054037	PP_01008; Ribosomal silencing factor RsfS	2.28e-27	Show
710	1054044..1055195	PP_01009; tRNA(Met) cytidine acetate ligase	1.09e-274	Show
711	1055909..1056625	PP_01011; Response regulator ArlR	1.68e-81	Show
712	1056612..1058180	PP_01012; Signal transduction histidine-protein kinase ArlS	1.3e-66	Show
713	1058216..1059184	PP_01013; Membrane protein insertase YidC 1	3.46e-56	Show
714	1059226..1059498	PP_01014; Acylphosphatase	4.67e-25	Show
715	1059624..1060391	PP_01015; 23S rRNA (guanosine(2553)-2'-O)-methyltransferase RlmP	1.71e-47	Show
716	1061127..1062176	PP_01017; Phenylalanine--tRNA ligase alpha subunit	5.21e-258	Show
717	1062180..1064594	PP_01018; Phenylalanine--tRNA ligase beta subunit	0.0	Show
718	1064670..1065146	PP_01019; Transcription elongation factor GreA	6.95e-54	Show
719	1065207..1066121	PP_01020; L-2-hydroxyisocaproate dehydrogenase	2.69e-83	Show
720	1066236..1067519	PP_01021; Peptidase T	3.03e-129	Show
721	1068689..1073572	PP_01024; PI-type proteinase	1.84e-55	Show
722	1073652..1074575	PP_01025; N-acetylmuramic acid/N-acetylglucosamine kinase	9.88e-18	Show
723	1077361..1079469	PP_01027; Penicillin-binding protein 2B	1.53e-131	Show
724	1079546..1079695	PP_01028; 50S ribosomal protein L33 1	1.07e-30	Show
725	1079749..1080312	PP_01029; Uncharacterized protein YqgN	1.94e-19	Show
726	1080347..1081027	PP_01030; RHOMBOID-like protein 7	6.25e-20	Show
727	1081304..1081705	PP_01032; Uncharacterized protein YqhL	1.29e-25	Show
728	1081777..1082697	PP_01033; tRNA dimethylallyltransferase	1.59e-219	Show
729	1082690..1083940	PP_01034; Uncharacterized 33.9 kDa protein in glnA 5'region	3.39e-154	Show
730	1084078..1085415	PP_01035; Glutamine synthetase	3.21e-236	Show
731	1085468..1086232	PP_01036; Probable iron export permease protein FetB	1.14e-92	Show
732	1086213..1086863	PP_01037; Probable iron export ATP-binding protein FetA	1.9e-58	Show
733	1093152..1094561	PP_01042; Lincomycin resistance protein LmrB	2.51e-101	Show
734	1094617..1095825	PP_01043; Acetate kinase	2.7e-137	Show
735	1095856..1097307	PP_01044; Glycerol kinase 1	7.53e-113	Show
736	1097322..1098263	PP_01045; Apulose-4-phosphate transketolase subunit B	8.94e-82	Show
737	1098256..1099089	PP_01046; Apulose-4-phosphate transketolase subunit A	6.53e-78	Show
738	1099219..1100232	PP_01047; HTH-type transcriptional repressor PurR	5.2e-31	Show
739	1103445..1104260	PP_01052; Uncharacterized glycosyltransferase YibD	2.19e-23	Show
740	1105435..1106181	PP_01054; Ribonuclease H	1.8e-19	Show
741	1107223..1108680	PP_01056; Cardiolipin synthase	9.58e-129	Show
742	1109253..1109957	PP_01058; NAD-dependent protein deacetylase	6.05e-73	Show
743	1109997..1110536	PP_01059; Methylated-DNA--protein-cysteine methyltransferase	1.03e-10	Show
744	1110523..1111311	PP_01060; Uncharacterized membrane protein YceF	6.71e-60	Show
745	1111358..1111717	PP_01061; Uncharacterized protein YeaO	5.69e-21	Show
746	1111785..1112417	PP_01062; Putative 3-methyladenine DNA glycosylase	6.19e-160	Show
747	1112749..1114362	PP_01063; Probable amino-acid ABC transporter permease protein HI_0179	4.36e-33	Show
748	1114362..1115117	PP_01064; Arginine transport ATP-binding protein ArtM	1.7e-84	Show
749	1118989..1120296	PP_01069; Uncharacterized glycosyltransferase YdaM	5.54e-68	Show
750	1123956..1125062	PP_01075; Inner membrane protein YbiR	2.61e-22	Show
751	1125161..1125721	PP_01076; Protein LemA	1.18e-63	Show
752	1125738..1126634	PP_01077; Protease HtpX homolog	6.94e-210	Show
753	1126672..1127613	PP_01078; Probable transcriptional regulator LumQ	9.98e-05	Show
754	1127759..1129108	PP_01079; Putative HMP/thiamine import ATP-binding protein YkoD	1.39e-51	Show
755	1129773..1130654	PP_01081; Proline iminopeptidase	6.55e-226	Show
756	1134850..1135329	PP_01087; Ribosomal RNA large subunit methyltransferase H	4.98e-107	Show
757	1135800..1136633	PP_01088; Serine protease Do-like HtrA	3.03e-168	Show
758	1136658..1137038	PP_01089; Serine protease Do-like HtrA	1.44e-42	Show
759	1137117..1137914	PP_01090; Putative metallo-hydrolase YycJ	7.48e-75	Show
760	1140087..1141943	PP_01093; Sensor protein kinase WalK	9.93e-158	Show
761	1142012..1142728	PP_01094; Transcriptional regulatory protein WalR	9.18e-118	Show
762	1142865..1142937	tRNA-Lys	0.0	Show
763	1143029..1144621	PP_01095; ABC transporter C family member 3	4.64e-22	Show
764	1144623..1146215	PP_01096; Probable ABC transporter ATP-binding/permease protein HI_0664	3.47e-23	Show
765	1150477..1151424	PP_01101; Hexosyltransferase GAUT11	1.96e-07	Show
766	1152777..1153418	PP_01104; Uncharacterized HTH-type transcriptional regulator YcgK	1.03e-14	Show
767	1153448..1154638	PP_01105; Urocanate reductase	6.69e-224	Show
768	1154953..1155297	PP_01106; Urocanate reductase	5.91e-38	Show
769	1158786..1159523	PP_01111; Arginine transport ATP-binding protein ArtM	4.31e-93	Show
770	1159516..1160991	PP_01112; Arginine transport system permease protein ArtQ	8.93e-36	Show
771	1162797..1163783	PP_01115; Putative ribose-phosphate pyrophosphokinase 2	5.14e-95	Show
772	1165198..1165542	PP_01119; Glutamate/serine transporter AimA	1.18e-40	Show
773	1165634..1166869	PP_01120; Serine hydroxymethyltransferase	7.68e-296	Show
774	1169091..1169552	PP_01126; Methylated-DNA--protein-cysteine methyltransferase	1.4e-46	Show
775	1170677..1171225	PP_01129; Uncharacterized MFS-type transporter YhcA	1.34e-36	Show
776	1174496..1175350	PP_01135; Nod factor export ATP-binding protein I	1.33e-40	Show
777	1175904..1177454	PP_01136; GMP synthase [glutamine-hydrolyzing]	0.0	Show
778	1177679..1178644	PP_01137; HTH-type transcriptional regulator ImmR	3.87e-06	Show
779	1179730..1180308	PP_01139; Xanthine phosphoribosyltransferase	1.36e-136	Show
780	1180316..1181596	PP_01140; Xanthine permease	6.41e-145	Show
781	1181690..1182295	PP_01141; Potassium channel HX13_20290	1.94e-10	Show
782	1182370..1183191	PP_01142; Raffinose operon transcriptional regulatory protein RafR	6.19e-79	Show
783	1183267..1184691	PP_01143; Dipeptidase A	0.0	Show
784	1184774..1186069	PP_01144; UDP-N-acetylglucosamine 1-carboxyvinyltransferase	8.94e-312	Show
785	1186199..1187818	PP_01145; CTP synthase	0.0	Show
786	1187936..1188490	PP_01146; Probable DNA-directed RNA polymerase subunit delta	3.17e-97	Show
787	1189057..1190421	PP_01148; Uncharacterized protein YwfO	6.79e-130	Show
788	1190782..1191690	PP_01150; Uncharacterized protein CPE0188	3.1e-34	Show
789	1191760..1193085	PP_01151; Lichenan permease IIC component	1.17e-78	Show
790	1193273..1193989	PP_01152; Uncharacterized HTH-type transcriptional regulator YfhH	6.05e-06	Show
791	1194119..1195546	PP_01153; 6-phospho-beta-glucosidase BglA	9.85e-209	Show
792	1195598..1196572	PP_01154; Ribose-phosphate pyrophosphokinase 1	3.1e-169	Show
793	1196852..1198537	PP_01155; S-layer protein	9.05e-06	Show
794	1200929..1202308	PP_01159; Bifunctional protein GlmU	0.0	Show
795	1202356..1203186	PP_01160; Pur operon repressor	2.27e-89	Show
796	1203292..1203549	PP_01161; Protein Veg	5.24e-22	Show
797	1203611..1204495	PP_01162; Ribosomal RNA small subunit methyltransferase A	1.7e-208	Show
798	1204485..1205072	PP_01163; Ribonuclease M5 1	1.29e-45	Show
799	1205059..1205826	PP_01164; Uncharacterized metal-dependent hydrolase YabD	1.25e-68	Show
800	1205826..1207802	PP_01165; Methionine--tRNA ligase	1.87e-310	Show
801	1207899..1210562	PP_01166; Magnesium-transporting ATPase, P-type 1	6.09e-199	Show
802	1211450..1211929	PP_01168; ComE operon protein 2	1.24e-58	Show
803	1211953..1212975	PP_01169; Tryptophan--tRNA ligase	1.48e-170	Show
804	1213722..1213792	tRNA-Gly	0.0	Show
805	1214587..1215048	PP_01172; Transcription elongation factor GreA 1	1.31e-44	Show
806	1215263..1215688	PP_01173; Heat shock protein HSP.16.4	4.48e-26	Show
807	1215832..1217148	PP_01174; Aminopeptidase E	9.56e-306	Show
808	1217189..1218133	PP_01175; Oligopeptide transport ATP-binding protein OppF	9.84e-149	Show
809	1218154..1219212	PP_01176; Dipeptide transport ATP-binding protein DppD	2.7e-171	Show
810	1219228..1220259	PP_01177; Dipeptide transport system permease protein DppC	1.24e-94	Show
811	1220267..1221196	PP_01178; Dipeptide transport system permease protein DppB	3.62e-96	Show
812	1221358..1222500	PP_01179; Inosine-5'-monophosphate dehydrogenase	3.6e-175	Show
813	1222648..1224276	PP_01180; Dipeptide-binding protein	3.62e-105	Show
814	1224356..1225981	PP_01181; Dipeptide-binding protein	6.11e-113	Show
815	1226151..1226804	PP_01182; Uncharacterized protein YpgQ	4.94e-23	Show
816	1226804..1228117	PP_01183; Aminopeptidase E	6.25e-168	Show
817	1228191..1228263	tRNA-Thr	0.0	Show
818	1228785..1230047	PP_01185; Tyrosine--tRNA ligase	1.21e-308	Show
819	1231793..1234783	PP_01187; Putative cyclic beta-1,2-glucan modification protein	1.76e-18	Show
820	1234826..1235443	PP_01188; Glycerol-3-phosphate acyltransferase 1	2.24e-146	Show
821	1235443..1236546	PP_01189; Polyisoprenyl-teichoic acid--peptidoglycan teichoic acid transferase TagU	3.36e-68	Show
822	1237272..1237874	PP_01191; Pyrrolidone-carboxylate peptidase	5.97e-144	Show
823	1238091..1238783	PP_01192; 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase	3.69e-171	Show
824	1240591..1241556	PP_01195; scyllo-inositol 2-dehydrogenase (NADP(+)) IolU	3.03e-44	Show
825	1241646..1243481	PP_01196; Putative Na(+)/H(+) antiporter YjbQ	4.08e-112	Show
826	1243605..1244699	PP_01197; Protein Ami	6.18e-44	Show
827	1245687..1245947	PP_01199; Probable N-acetylmuramidase	2.57e-05	Show
828	1246311..1247684	PP_01200; S-layer protein	1.32e-138	Show
829	1250657..1252000	PP_01204; S-layer protein	1.15e-287	Show
830	1254118..1255065	PP_01207; Probable potassium transport system protein Kup 1	9.29e-212	Show
831	1255111..1256136	PP_01208; Probable potassium transport system protein Kup 1	6.11e-227	Show
832	1256315..1258267	PP_01209; Neutral endopeptidase	3.09e-287	Show
833	1258341..1259558	PP_01210; Uncharacterized MFS-type transporter YttB	5.69e-58	Show
834	1260876..1261439	PP_01212; Fe-S protein maturation auxiliary factor YitW	4.7e-26	Show
835	1261496..1262209	PP_01213; Anaerobic ribonucleoside-triphosphate reductase-activating protein	3.63e-36	Show
836	1262193..1264388	PP_01214; Anaerobic ribonucleoside-triphosphate reductase	4.31e-240	Show
837	1264567..1265835	PP_01215; D-aspartate ligase	1.19e-186	Show
838	1265857..1267806	PP_01216; Asparagine synthetase [glutamine-hydrolyzing] 1	1.89e-123	Show
839	1270011..1270583	PP_01219; Probable GMP synthase [glutamine-hydrolyzing]	6.62e-47	Show
840	1270631..1271443	PP_01220; Phosphite transport system permease protein PtxC	9.38e-42	Show
841	1271443..1272240	PP_01221; Phosphite transport system permease protein PtxC	1.36e-39	Show
842	1272240..1273013	PP_01222; Phosphonates import ATP-binding protein PhnC	8.97e-181	Show
843	1273039..1273968	PP_01223; Probable phosphite transport system-binding protein PtxB	1.24e-15	Show
844	1274313..1274798	PP_01224; Putative universal stress protein SERP1273	8.54e-26	Show
845	1274948..1275751	PP_01225; Putative tyrosine-protein phosphatase H16_A0669	1.72e-23	Show
846	1276376..1276567	PP_01227; Nucleoside deoxyribosyltransferase	2.88e-31	Show
847	1276622..1276852	PP_01228; Nucleoside deoxyribosyltransferase	3.91e-47	Show
848	1277222..1278376	PP_01229; N-acetylglucosamine-6-phosphate deacetylase	1.62e-59	Show
849	1278532..1281546	PP_01230; Probable maltase-glucoamylase 2	4.59e-17	Show
850	1285540..1286622	PP_01236; D-alanine--D-alanine ligase	5.93e-265	Show
851	1288081..1290000	PP_01238; Lactose permease	0.0	Show
852	1290011..1292014	PP_01239; Beta-galactosidase LacZ	0.0	Show
853	1294166..1295329	PP_01242; Galactokinase	4.52e-251	Show
854	1295349..1296812	PP_01243; Galactose-1-phosphate uridylyltransferase	2.39e-315	Show
855	1296814..1297800	PP_01244; Aldose 1-epimerase (Fragment)	3.02e-70	Show
856	1301657..1303129	PP_01251; Uncharacterized MFS-type transporter YcnB	3.77e-151	Show
857	1303290..1303724	PP_01252; HTH-type transcriptional regulator TnrA	7.86e-06	Show
858	1303782..1304621	PP_01253; Raffinose operon transcriptional regulatory protein RafR	1.45e-101	Show
859	1304865..1306121	PP_01254; Multiple sugar-binding protein	8.3e-181	Show
860	1306135..1307010	PP_01255; Multiple sugar-binding transport system permease protein MsmF	2.88e-157	Show
861	1307023..1307856	PP_01256; Multiple sugar-binding transport system permease protein MsmG	1.27e-158	Show
862	1307888..1309000	PP_01257; Multiple sugar-binding transport ATP-binding protein MsmK	3.29e-174	Show
863	1309012..1311210	PP_01258; Alpha-galactosidase Mel36A	0.0	Show
864	1311220..1312662	PP_01259; Sucrose phosphorylase	2.72e-255	Show
865	1312911..1313618	PP_01260; Glycerol uptake facilitator protein 2	4.02e-125	Show
866	1313636..1314007	PP_01261; PTS-dependent dihydroxyacetone kinase, phosphotransferase subunit DhaM	1.23e-37	Show
867	1314004..1314588	PP_01262; PTS-dependent dihydroxyacetone kinase, ADP-binding subunit DhaL	2.48e-63	Show
868	1314601..1315596	PP_01263; PTS-dependent dihydroxyacetone kinase, dihydroxyacetone-binding subunit DhaK	3.51e-155	Show
869	1315824..1316435	PP_01264; GTP pyrophosphokinase YwaC	1.88e-31	Show
870	1316443..1317108	PP_01265; Transcriptional regulatory protein TrcR	2.53e-42	Show
871	1317118..1318392	PP_01266; Sensor protein CiaH	2.07e-25	Show
872	1322775..1324271	PP_01273; Inner membrane transporter YjeM	4.65e-140	Show
873	1324575..1325129	PP_01275; Uncharacterized isochorismatase family protein PncA	1.31e-70	Show
874	1327287..1328207	PP_01279; Probable NADH-dependent flavin oxidoreductase YqiG	5.88e-48	Show
875	1328874..1330151	PP_01281; Poly-beta-1,6-N-acetyl-D-glucosamine synthase	4.09e-48	Show
876	1331818..1332921	PP_01284; Uncharacterized protein YhcK	1.05e-21	Show
877	1333792..1335906	PP_01287; Urocanate reductase	3.12e-23	Show
878	1336015..1336869	PP_01288; HTH-type transcriptional regulator ClcR	1.34e-09	Show
879	1339277..1339618	PP_01292; Endoribonuclease MazF	3.69e-07	Show
880	1339852..1340490	PP_01293; UPF0659 protein YMR090W	2.12e-20	Show
881	1341453..1342817	PP_01296; NADH peroxidase	1.06e-137	Show
882	1343087..1344832	PP_01298; Oligopeptide-binding protein OppA	5.29e-127	Show
883	1345146..1345460	PP_01299; Fe-S protein maturation auxiliary factor YitW	1.63e-26	Show
884	1345470..1346351	PP_01300; Probable L-serine dehydratase, alpha chain	1.17e-114	Show
885	1346365..1347030	PP_01301; Probable L-serine dehydratase, beta chain	2.57e-45	Show
886	1347536..1348387	PP_01303; Probable D-methionine-binding lipoprotein MetQ	5.97e-50	Show
887	1363872..1365218	PP_01308; H(+)/Cl(-) exchange transporter ClcA	8.19e-42	Show
888	1365302..1367929	PP_01309; Calcium-transporting ATPase 1	5.69e-244	Show
889	1369076..1369714	PP_01312; Orotate phosphoribosyltransferase	3.78e-137	Show
890	1369714..1370421	PP_01313; Orotidine 5'-phosphate decarboxylase	2.13e-168	Show
891	1370674..1371597	PP_01314; Dihydroorotate dehydrogenase A (fumarate)	1.11e-215	Show
892	1371774..1372316	PP_01315; Bifunctional protein PyrR	5.5e-91	Show
893	1372457..1373413	PP_01316; Aspartate carbamoyltransferase	1.19e-236	Show
894	1373413..1374690	PP_01317; Dihydroorotase	1.67e-313	Show
895	1374691..1375776	PP_01318; Carbamoyl-phosphate synthase small chain	1.28e-153	Show
896	1375769..1378957	PP_01319; Carbamoyl-phosphate synthase large chain	0.0	Show
897	1383410..1384273	PP_01322; Putative sugar uptake protein LJ_0170	1.79e-128	Show
898	1384727..1385164	PP_01324; Peptide methionine sulfoxide reductase MsrB	2.18e-69	Show
899	1385228..1387609	PP_01325; Xaa-Pro dipeptidyl-peptidase	0.0	Show
900	1389637..1390890	PP_01330; Putative permease IIC component YwbA	8.73e-72	Show
901	1391021..1392166	PP_01331; Xylose repressor	4.04e-58	Show
902	1392304..1393188	PP_01332; Beta-glucoside kinase	1.08e-30	Show
903	1393178..1394668	PP_01333; Aryl-phospho-beta-D-glucosidase BglC	6.26e-183	Show
904	1394673..1396952	PP_01334; Alpha-xylosidase	4.92e-259	Show
905	1396966..1399008	PP_01335; Beta-galactosidase GanA	5.81e-255	Show
906	1401199..1402014	PP_01337; 5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YcsE	1.39e-14	Show
907	1402347..1403924	PP_01338; ATP-dependent lipid A-core flippase	1.63e-18	Show
908	1403924..1405507	PP_01339; Iron-sulfur clusters transporter ATM1, mitochondrial	4.74e-19	Show
909	1405542..1405901	PP_01340; Global transcriptional regulator Spx	1.24e-12	Show
910	1405912..1406808	PP_01341; Putative alpha/beta hydrolase R526	4.23e-11	Show
911	1408262..1408338	tRNA-Arg	0.0	Show
912	1408670..1409902	PP_01343; D-alanyl-L-alanine endopeptidase	7.92e-25	Show
913	1412743..1413525	PP_01346; Probable aminoglycoside 3'-phosphotransferase	5.57e-88	Show
914	1413925..1414479	PP_01347; Periplasmic oligopeptide-binding protein	1.36e-27	Show
915	1416118..1416699	PP_01351; Uncharacterized protein YJL213W	1.29e-11	Show
916	1416773..1416952	PP_01352; Probable tautomerase EF_2859	1.67e-27	Show
917	1417003..1418028	PP_01353; Branched-chain-amino-acid aminotransferase	5.67e-133	Show
918	1419619..1420455	PP_01355; UPF0750 membrane protein YqfU	2.94e-20	Show
919	1420622..1420933	PP_01356; 50S ribosomal protein L21	4.78e-67	Show
920	1420952..1421242	PP_01357; 50S ribosomal protein L27	2.76e-65	Show
921	1421367..1422476	PP_01358; Uncharacterized peptidase YqhT	2.03e-74	Show
922	1422557..1423126	PP_01359; Elongation factor P 2	6.02e-134	Show
923	1423145..1423579	PP_01360; Uncharacterized protein YqhY	4.24e-26	Show
924	1423579..1423971	PP_01361; Transcription antitermination protein NusB	6.85e-15	Show
925	1424265..1425116	PP_01362; Bifunctional protein FolD	4.14e-199	Show
926	1425103..1426470	PP_01363; Exodeoxyribonuclease 7 large subunit	2.27e-308	Show
927	1426451..1426693	PP_01364; Exodeoxyribonuclease 7 small subunit	7.57e-49	Show
928	1426696..1427565	PP_01365; Geranylgeranyl pyrophosphate synthase	5.28e-54	Show
929	1427566..1428378	PP_01366; Putative rRNA methyltransferase YqxC	1.13e-89	Show
930	1428389..1430071	PP_01367; DNA repair protein RecN	1.88e-133	Show
931	1430612..1431226	PP_01369; Guanylate kinase	2.52e-147	Show
932	1431229..1431453	PP_01370; DNA-directed RNA polymerase subunit omega	3.36e-47	Show
933	1431504..1433903	PP_01371; Primosomal protein N'	1.33e-246	Show
934	1433916..1434860	PP_01372; Methionyl-tRNA formyltransferase	8.87e-221	Show
935	1434847..1436178	PP_01373; Probable ribosomal RNA small subunit methyltransferase B	1.12e-88	Show
936	1436183..1436938	PP_01374; Protein phosphatase PrpC	4.79e-59	Show
937	1436928..1438952	PP_01375; Serine/threonine-protein kinase PrkC	1.49e-144	Show
938	1438954..1439844	PP_01376; Small ribosomal subunit biogenesis GTPase RsgA	2.35e-216	Show
939	1439855..1440505	PP_01377; Ribulose-phosphate 3-epimerase	9.7e-49	Show
940	1441654..1441839	PP_01380; 50S ribosomal protein L28	7.97e-38	Show
941	1442007..1442369	PP_01381; Uncharacterized protein Spy1614	2.21e-46	Show
942	1442391..1444052	PP_01382; Uncharacterized protein SA1069	5.04e-174	Show
943	1444057..1446093	PP_01383; ATP-dependent DNA helicase RecG	1.42e-203	Show
944	1446113..1447114	PP_01384; Phosphate acyltransferase	2.7e-236	Show
945	1447147..1447389	PP_01385; Acyl carrier protein	7.57e-49	Show
946	1447506..1448537	PP_01386; Oligopeptide transport ATP-binding protein OppD	1.52e-117	Show
947	1448541..1449527	PP_01387; Oligopeptide transport ATP-binding protein OppF	1.75e-144	Show
948	1449530..1450489	PP_01388; Oligopeptide transport system permease protein OppB	2.38e-130	Show
949	1450504..1451433	PP_01389; Oligopeptide transport system permease protein OppC	1.43e-80	Show
950	1451599..1453368	PP_01390; Oligopeptide-binding protein OppA	1.99e-135	Show
951	1453570..1455339	PP_01391; Oligopeptide-binding protein OppA	1.95e-129	Show
952	1455504..1456811	PP_01392; Serine--tRNA ligase	0.0	Show
953	1457589..1458197	PP_01394; Uncharacterized membrane protein YhjE	1.14e-08	Show
954	1458359..1459153	PP_01395; Probable carboxylesterase 17	4.12e-05	Show
955	1460723..1462105	PP_01398; Succinate-semialdehyde dehydrogenase [NADP(+)]	2.04e-125	Show
956	1467713..1473487	PP_01400; C protein alpha-antigen	3.46e-45	Show
957	1475024..1478737	PP_01402; Putative membrane protein YdgH	2.25e-76	Show
958	1484090..1484914	PP_01408; sn-glycerol-3-phosphate transport system permease protein UgpE	1.98e-35	Show
959	1484918..1485784	PP_01409; Probable ABC transporter permease protein MG188	1.74e-39	Show
960	1485784..1486869	PP_01410; Trehalose/maltose import ATP-binding protein MalK	6.18e-76	Show
961	1487130..1488557	PP_01411; Probable dipeptidase	4.17e-136	Show
962	1488600..1489457	PP_01412; DNA-entry nuclease	6.1e-18	Show
963	1489467..1490423	PP_01413; DNA polymerase III PolC-type	5.06e-20	Show
964	1500718..1502322	PP_01422; Beta-(1-->2)glucan export ATP-binding/permease protein NdvA	2.02e-28	Show
965	1502440..1503357	PP_01423; Proline iminopeptidase	2.25e-41	Show
966	1503416..1504117	PP_01424; Uncharacterized transcriptional regulatory protein YkoG	1.08e-57	Show
967	1504119..1505444	PP_01425; Sensor histidine kinase YkoH	4.43e-31	Show
968	1506818..1507273	PP_01428; Uncharacterized HTH-type transcriptional regulator YybA	6.03e-51	Show
969	1507852..1509492	PP_01430; Dipeptide-binding protein	2.15e-108	Show
970	1510940..1511515	PP_01433; Elongation factor P 1	4.23e-135	Show
971	1511639..1512553	PP_01434; Pantothenate kinase	1.79e-103	Show
972	1517522..1518859	PP_01442; 6-phospho-alpha-glucosidase 1	2.34e-202	Show
973	1519748..1520740	PP_01444; L-asparaginase 1	8.43e-83	Show
974	1522067..1524706	PP_01448; Calcium-transporting ATPase 1	2.55e-243	Show
975	1526921..1527670	PP_01451; Bacitracin export ATP-binding protein BceA	4.55e-82	Show
976	1529516..1530166	PP_01453; 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase	1.79e-14	Show
977	1531067..1533373	PP_01455; DNA helicase IV	5.86e-165	Show
978	1533805..1534452	PP_01456; Arginine transport system permease protein ArtQ	2.05e-36	Show
979	1534466..1535086	PP_01457; Arginine transport ATP-binding protein ArtM	5.02e-54	Show
980	1535090..1535551	PP_01458; Histidine-binding periplasmic protein	5.97e-08	Show
981	1536377..1537975	PP_01460; Bifunctional aspartate aminotransferase and L-aspartate beta-decarboxylase	1.71e-123	Show
982	1537991..1539649	PP_01461; Aspartate/alanine antiporter	7.56e-102	Show
983	1541975..1542736	PP_01464; Exodeoxyribonuclease	5.08e-77	Show
984	1547478..1548332	PP_01467; Uncharacterized HTH-type transcriptional regulator YbbH	1.34e-40	Show
985	1548342..1549403	PP_01468; 6-phospho-N-acetylmuramidase	5.9e-45	Show
986	1549462..1550358	PP_01469; N-acetylmuramic acid 6-phosphate etherase	1.01e-202	Show
987	1550370..1552361	PP_01470; PTS system MurNAc-GlcNAc-specific EIIBC component	1.52e-182	Show
988	1552687..1554168	PP_01471; Aryl-phospho-beta-D-glucosidase BglH	7.2e-154	Show
989	1554181..1556058	PP_01472; PTS system beta-glucoside-specific EIIBCA component	2.9e-122	Show
990	1556055..1556909	PP_01473; Transcription antiterminator LicT	7.1e-59	Show
991	1560970..1564527	PP_01476; Pullulanase	3.3e-146	Show
992	1574984..1575868	PP_01486; UTP--glucose-1-phosphate uridylyltransferase 1	6.8e-139	Show
993	1576023..1577165	PP_01487; UDP-N-acetylglucosamine 2-epimerase	1.64e-163	Show
994	1580054..1581487	PP_01491; Lipid II flippase MurJ	2.57e-10	Show
995	1581493..1582605	PP_01492; UDP-galactopyranose mutase	2.26e-167	Show
996	1583922..1584962	PP_01494; Uncharacterized glycosyltransferase MG025 homolog	2.97e-13	Show
997	1587797..1588447	PP_01498; Galactosyl transferase CpsE	6.44e-61	Show
998	1588540..1589310	PP_01499; Tyrosine-protein phosphatase YwqE	3.64e-57	Show
999	1589313..1590095	PP_01500; Tyrosine-protein kinase YwqD	2.83e-56	Show
1000	1590111..1590986	PP_01501; Capsular polysaccharide type 8 biosynthesis protein cap8A	3.95e-20	Show
1001	1591008..1592063	PP_01502; Polyisoprenyl-teichoic acid--peptidoglycan teichoic acid transferase TagU	2.04e-51	Show
1002	1592229..1593422	PP_01503; GTPase HflX	1.31e-74	Show
1003	1599333..1600232	PP_01506; Gamma-DL-glutamyl hydrolase	4.27e-14	Show
1004	1600387..1601175	PP_01507; Murein DD-endopeptidase MepS/Murein LD-carboxypeptidase	8.19e-15	Show
1005	1601473..1602027	PP_01508; Murein DD-endopeptidase MepH	3.1e-19	Show
1006	1602221..1602763	PP_01509; Guanylate kinase	2.91e-19	Show
1007	1605545..1605991	PP_01513; Protein NrdI	3.47e-27	Show
1008	1605994..1606929	PP_01514; Ribonucleoside-diphosphate reductase subunit beta nrdF1	2.2e-61	Show
1009	1607606..1608328	PP_01516; Uncharacterized protein YvpB	2.39e-40	Show
1010	1608334..1608651	PP_01517; Fe-S protein maturation auxiliary factor YitW	4.54e-24	Show
1011	1608648..1608944	PP_01518; FeS cluster assembly protein SufB	2.45e-40	Show
1012	1608925..1609155	PP_01519; Probable ABC transporter ATP-binding protein SpyM3_0208	3.86e-23	Show
1013	1610731..1612272	PP_01522; Uncharacterized ABC transporter ATP-binding protein YfmM	7.14e-137	Show
1014	1613354..1614628	PP_01525; Polyisoprenyl-teichoic acid--peptidoglycan teichoic acid transferase TagU	9.36e-71	Show
1015	1614796..1616592	PP_01526; Oligoendopeptidase F homolog	3.11e-207	Show
1016	1617283..1618797	PP_01528; L-lactate permease	2.56e-145	Show
1017	1619616..1620410	PP_01530; Probable iron transport system membrane protein HI_0359	2.62e-16	Show
1018	1620410..1621057	PP_01531; Zinc import ATP-binding protein ZnuC	9.08e-37	Show
1019	1621095..1621991	PP_01532; Manganese ABC transporter substrate-binding lipoprotein	6.46e-18	Show
1020	1623687..1624412	PP_01536; Fructose permease IIC component (Fragment)	1.15e-60	Show
1021	1624497..1625684	PP_01537; PTS system fructose-specific EIIABC component	7.58e-85	Show
1022	1625708..1626622	PP_01538; 1-phosphofructokinase	3.61e-87	Show
1023	1626624..1627379	PP_01539; Uncharacterized HTH-type transcriptional regulator FruR	1.41e-57	Show
1024	1627582..1628637	PP_01540; Protein adenylyltransferase FICD	3.06e-07	Show
1025	1628792..1630003	PP_01541; Uncharacterized protein YhaP	6.79e-22	Show
1026	1629996..1630892	PP_01542; Uncharacterized ABC transporter ATP-binding protein YhaQ	2.72e-73	Show
1027	1632221..1632430	PP_01546; Uncharacterized HTH-type transcriptional regulator YozG	6.47e-23	Show
1028	1635794..1636384	PP_01554; Uncharacterized protein LBA1794	7.85e-138	Show
1029	1636395..1638557	PP_01555; Transport/processing ATP-binding protein ComA	3.38e-283	Show
1030	1647578..1649881	PP_01568; Alpha-glucosidase 2	5.85e-190	Show
1031	1651328..1652077	PP_01573; Aspartate racemase	4.63e-72	Show
1032	1652088..1653659	PP_01574; UDP-N-acetylmuramyl-tripeptide synthetase	0.0	Show
1033	1653715..1654860	PP_01575; Sensor protein VanS	5.57e-40	Show
1034	1654862..1655548	PP_01576; Regulatory protein VanR	2.57e-55	Show
1035	1655697..1657571	PP_01577; Uncharacterized ABC transporter ATP-binding protein TM_0288	1.46e-138	Show
1036	1657564..1659294	PP_01578; Uncharacterized ABC transporter ATP-binding protein YfiB	3.85e-100	Show
1037	1660202..1661302	PP_01580; Ribosome-binding ATPase YchF	2.25e-161	Show
1038	1661359..1661622	PP_01581; Uncharacterized protein YyzM	2.87e-21	Show
1039	1661615..1662499	PP_01582; Stage 0 sporulation protein J	2.27e-93	Show
1040	1662477..1663256	PP_01583; Sporulation initiation inhibitor protein Soj	6.39e-116	Show
1041	1663272..1664102	PP_01584; Nucleoid occlusion protein	5.43e-76	Show
1042	1664120..1664842	PP_01585; Ribosomal RNA small subunit methyltransferase G	3.12e-168	Show
1043	1665596..1666525	PP_01587; FAD:protein FMN transferase	4.41e-68	Show
1044	1666529..1667320	PP_01588; Tyrosine-protein phosphatase	6.75e-11	Show
1045	1667407..1667955	PP_01589; NADH-dependent flavin reductase subunit 2	3.1e-71	Show
1046	1667967..1668506	PP_01590; NADH-dependent flavin reductase subunit 1	5.89e-74	Show
1047	1669735..1671147	PP_01593; Probable dipeptidase	3.93e-107	Show
1048	1671186..1671860	PP_01594; Putative hemin import ATP-binding protein HrtA	1.66e-55	Show
1049	1673570..1674169	PP_01597; 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase	3.09e-07	Show
1050	1675052..1675813	PP_01599; UPF0246 protein LBA1843	7.15e-185	Show
1051	1676541..1677335	PP_01601; Di-/tripeptide transporter	2.5e-25	Show
1052	1679015..1680508	PP_01604; Uncharacterized transporter YclF	3.3e-151	Show
1053	1680620..1683154	PP_01605; Aminopeptidase N	0.0	Show
1054	1685004..1685573	PP_01608; Multidrug resistance protein MdtG	1.73e-41	Show
1055	1685573..1686247	PP_01609; Multidrug resistance protein MdtG	4.5e-53	Show
1056	1687877..1688383	PP_01612; Macro domain-containing protein MA_1614	6.47e-55	Show
1057	1688479..1690242	PP_01613; Subtilin transport ATP-binding protein SpaT	7.45e-71	Show
1058	1692927..1693784	PP_01619; Maltodextrin transport system permease protein MalD	3.52e-44	Show
1059	1693787..1695145	PP_01620; Galactooligosaccharides transport system permease protein GanP	5.37e-65	Show
1060	1696529..1697635	PP_01622; Multiple sugar-binding transport ATP-binding protein MsmK	4.32e-174	Show
1061	1697768..1697880	5S_rRNA	0.0	Show
1062	1697954..1700856	23S_rRNA	0.0	Show
1063	1701061..1701860	16S_rRNA	0.0	Show
1064	1701903..1702568	PP_01623; Beta-phosphoglucomutase	2.22e-61	Show
1065	1702553..1704823	PP_01624; Maltose phosphorylase	2.6e-318	Show
1066	1704994..1706715	PP_01625; Intracellular maltogenic amylase	7.0e-179	Show
1067	1706719..1708374	PP_01626; Oligo-1,6-glucosidase	1.94e-120	Show
1068	1708486..1709661	PP_01627; Acetate kinase	2.95e-141	Show
1069	1709802..1710752	PP_01628; Uncharacterized HTH-type transcriptional regulator YvdE	1.1e-102	Show
1070	1710761..1711534	PP_01629; Putative tyrosine-protein phosphatase H16_A0669	2.07e-14	Show
1071	1711623..1713203	PP_01630; ATP-dependent lipid A-core flippase	1.16e-24	Show
1072	1714250..1715752	PP_01633; Glycerol kinase	0.0	Show
1073	1715883..1716701	PP_01634; Hydroxymethylpyrimidine/phosphomethylpyrimidine kinase	1.86e-62	Show
1074	1717381..1718211	PP_01636; Putative RNA-guided DNA endonuclease	3.03e-37	Show
1075	1718496..1719182	PP_01637; Lipid II isoglutaminyl synthase (glutamine-hydrolyzing) subunit GatD	1.07e-55	Show
1076	1719242..1719724	PP_01638; Probable endopeptidase cgR_2070	1.26e-16	Show
1077	1719890..1720810	PP_01639; Uncharacterized inner membrane transporter YicL	4.21e-43	Show
1078	1721799..1722701	PP_01641; Uncharacterized transporter YdeD	2.44e-49	Show
1079	1723961..1725256	PP_01644; Adenylosuccinate lyase	1.36e-202	Show
1080	1725260..1726549	PP_01645; Adenylosuccinate synthetase	0.0	Show
1081	1726748..1727740	PP_01646; GMP reductase	1.64e-240	Show
1082	1727940..1728013	tRNA-Arg	0.0	Show
1083	1728023..1728096	tRNA-Pro	0.0	Show
1084	1729676..1730686	PP_01648; Aspartate--ammonia ligase	1.86e-249	Show
1085	1730760..1731284	PP_01649; D-alanyl-L-alanine endopeptidase	1.54e-16	Show
1086	1734144..1735430	PP_01653; Protein DltD	3.96e-114	Show
1087	1735423..1735662	PP_01654; D-alanyl carrier protein	8.56e-50	Show
1088	1735697..1736935	PP_01655; Teichoic acid D-alanyltransferase	7.69e-152	Show
1089	1736935..1738449	PP_01656; D-alanine--D-alanyl carrier protein ligase	4.92e-182	Show
1090	1740794..1741270	PP_01660; Uncharacterized protein MJ1426	3.71e-06	Show
1091	1741391..1743247	PP_01661; Cadmium-transporting ATPase	1.1e-85	Show
1092	1743394..1744563	PP_01662; Na(+)/H(+) antiporter	1.25e-108	Show
1093	1745555..1747117	PP_01664; ATP-dependent lipid A-core flippase	6.7e-21	Show
1094	1748845..1749246	PP_01667; HTH-type transcriptional regulator ImmR	9.86e-10	Show
1095	1751149..1753359	PP_01670; Uncharacterized ABC transporter ATP-binding protein YknY	1.85e-56	Show
1096	1754287..1755288	PP_01672; ABC transporter nucleoside-binding protein BmpA	1.07e-75	Show
1097	1755502..1756587	PP_01673; ABC transporter nucleoside-binding protein BmpA	4.11e-110	Show
1098	1756654..1758192	PP_01674; Nucleoside import ATP-binding protein NupA	1.79e-208	Show
1099	1758185..1759336	PP_01675; Nucleoside ABC transporter permease protein NupB	2.87e-106	Show
1100	1759337..1760293	PP_01676; Nucleoside ABC transporter permease protein NupC	1.73e-141	Show
1101	1760400..1761227	PP_01677; Uncharacterized protein YeaE	5.4e-77	Show
1102	1761347..1762066	PP_01678; Glucosamine-6-phosphate deaminase	2.4e-176	Show
1103	1762245..1762892	PP_01679; Deoxyadenosine kinase	4.48e-151	Show
1104	1762918..1763604	PP_01680; Deoxyguanosine kinase	5.66e-165	Show
1105	1763663..1764463	PP_01681; Putative phosphatase HI_0003	2.31e-33	Show
1106	1764688..1765995	PP_01682; Guanine/hypoxanthine permease PbuG	2.35e-145	Show
1107	1766376..1767200	PP_01683; Ferredoxin--NADP reductase	9.78e-195	Show
1108	1767210..1767860	PP_01684; Protein DedA	2.24e-58	Show
1109	1768475..1769251	PP_01686; 5'-nucleotidase YutF	1.21e-64	Show
1110	1769852..1771234	PP_01688; Uncharacterized metallophosphoesterase YunD	9.44e-83	Show
1111	1771669..1773036	PP_01690; Uncharacterized protein YqiK	3.87e-10	Show
1112	1773071..1774072	PP_01691; HTH-type transcriptional regulator pepR1	4.17e-185	Show
1113	1774217..1775323	PP_01692; Xaa-Pro dipeptidase	1.69e-259	Show
1114	1776294..1777145	PP_01695; Uncharacterized MscS family protein YkuT	4.0e-38	Show
1115	1777182..1777802	PP_01696; dITP/XTP pyrophosphatase	8.53e-146	Show
1116	1777802..1778605	PP_01697; Glutamate racemase	1.89e-187	Show
1117	1779211..1779585	PP_01699; Large-conductance mechanosensitive channel	1.24e-72	Show
1118	1779629..1779940	PP_01700; Thioredoxin	1.89e-39	Show
1119	1780018..1782375	PP_01701; Endonuclease MutS2	0.0	Show
1120	1782434..1782745	PP_01702; UPF0473 protein LBA0420	8.26e-68	Show
1121	1782747..1783175	PP_01703; Putative pre-16S rRNA nuclease	4.62e-97	Show
1122	1783175..1783432	PP_01704; UPF0297 protein LBA0418	2.63e-58	Show
1123	1783493..1786132	PP_01705; Alanine--tRNA ligase	0.0	Show
1124	1786374..1787735	PP_01706; DEAD-box ATP-dependent RNA helicase CshB	6.96e-122	Show
1125	1787728..1788684	PP_01707; Probable bifunctional oligoribonuclease and PAP phosphatase NrnA	1.36e-97	Show
1126	1788747..1789808	PP_01708; DNA polymerase IV	2.34e-89	Show
1127	1789861..1791312	PP_01709; Glucose-6-phosphate 1-dehydrogenase	1.98e-144	Show
1128	1791879..1792895	PP_01711; Holliday junction branch migration complex subunit RuvB	6.54e-240	Show
1129	1792940..1793527	PP_01712; Holliday junction branch migration complex subunit RuvA	9.92e-136	Show
1130	1793527..1795422	PP_01713; DNA mismatch repair protein MutL	0.0	Show
1131	1795425..1798019	PP_01714; DNA mismatch repair protein MutS	0.0	Show
1132	1798146..1799774	PP_01715; Chaperonin GroEL	0.0	Show
1133	1799797..1800081	PP_01716; Co-chaperonin GroES	5.23e-60	Show
1134	1802187..1804136	PP_01720; PTS system sucrose-specific EIIBCA component	1.44e-289	Show
1135	1804371..1805828	PP_01721; Sucrose-6-phosphate hydrolase	2.67e-154	Show
1136	1805845..1806831	PP_01722; Sucrose operon repressor	4.07e-123	Show
1137	1806879..1807514	PP_01723; Redox-sensing transcriptional repressor Rex	3.97e-145	Show
1138	1807698..1809617	PP_01724; Putative ATP-binding protein YdiF	4.1e-157	Show
1139	1809740..1811506	PP_01725; Oxalyl-CoA decarboxylase	1.08e-197	Show
1140	1811506..1812843	PP_01726; Formyl-CoA:oxalate CoA-transferase	2.79e-143	Show
1141	1812915..1814102	PP_01727; Acetyl-CoA:oxalate CoA-transferase	9.31e-109	Show
1142	1814151..1814861	PP_01728; HTH-type transcriptional repressor GamR	7.48e-24	Show
1143	1814854..1815825	PP_01729; Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase	9.44e-14	Show
1144	1815835..1816548	PP_01730; Deoxyribose-phosphate aldolase	1.28e-170	Show
1145	1816686..1817735	PP_01731; tRNA N6-adenosine threonylcarbamoyltransferase	3.23e-252	Show
1146	1817732..1818304	PP_01732; N-alpha-acetyltransferase RimI	6.85e-17	Show
1147	1818288..1819022	PP_01733; tRNA threonylcarbamoyladenosine biosynthesis protein TsaB	7.25e-18	Show
1148	1819050..1819568	PP_01734; Folate transporter FolT	6.22e-24	Show
1149	1820356..1821210	PP_01736; Ribosomal RNA small subunit methyltransferase I	2.31e-76	Show
1150	1821210..1821581	PP_01737; Initiation-control protein YabA	4.04e-46	Show
1151	1821572..1822429	PP_01738; DNA polymerase III subunit delta'	6.04e-11	Show
1152	1822430..1822750	PP_01739; Cyclic di-AMP receptor A	1.96e-29	Show
1153	1822751..1823401	PP_01740; Thymidylate kinase	3.4e-151	Show
1154	1823742..1824341	PP_01742; Recombination protein RecR	2.63e-142	Show
1155	1824342..1824677	PP_01743; Nucleoid-associated protein LBA0378	3.78e-70	Show
1156	1824818..1826152	PP_01744; Protein DETOXIFICATION 42	1.68e-12	Show
1157	1827146..1827784	PP_01746; Uncharacterized protein HI_0522	1.52e-08	Show
1158	1827747..1829189	PP_01747; 6-phospho-beta-glucosidase	9.29e-202	Show
1159	1829191..1830873	PP_01748; PTS system beta-glucoside-specific EIIBCA component	1.77e-127	Show
1160	1830863..1831066	PP_01749; PTS system beta-glucoside-specific EIIBCA component	1.42e-17	Show
1161	1834388..1835701	PP_01752; UDP-N-acetylmuramate--L-alanine ligase	0.0	Show
1162	1835803..1836450	PP_01753; Putative tRNA-binding protein YtpR	4.39e-43	Show
1163	1836470..1836790	PP_01754; Thioredoxin-like protein YtpP	1.19e-32	Show
1164	1836856..1837512	PP_01755; tRNA (guanine-N(7)-)-methyltransferase	1.06e-164	Show
1165	1838720..1839463	PP_01757; ABC-type transporter ATP-binding protein EcsA	1.14e-80	Show
1166	1839557..1839988	PP_01758; Protein hit	6.14e-38	Show
1167	1840453..1841355	PP_01760; Foldase protein PrsA 1	1.04e-140	Show
1168	1841425..1842402	PP_01761; 3'-5' exoribonuclease YhaM	7.19e-90	Show
1169	1844874..1846085	PP_01763; Uncharacterized metallophosphoesterase YhaO	2.4e-47	Show
1170	1846094..1846444	PP_01764; UPF0342 protein LBA1592	5.68e-72	Show
1171	1846460..1848517	PP_01765; Penicillin-binding protein 2a	2.02e-170	Show
1172	1848607..1849452	PP_01766; Uncharacterized RNA pseudouridine synthase YlyB	1.18e-32	Show
1173	1849586..1850338	PP_01767; Glycerol uptake facilitator protein-like 5	6.08e-118	Show
1174	1851217..1852239	PP_01769; L-lactate oxidase	2.36e-20	Show
1175	1852370..1853281	PP_01770; Fructose-bisphosphate aldolase	1.04e-106	Show
1176	1853390..1855075	PP_01771; Arginine--tRNA ligase	0.0	Show
1177	1855348..1856037	PP_01772; Putative L,D-transpeptidase YciB	4.17e-30	Show
1178	1856137..1856985	PP_01773; ADP-dependent (S)-NAD(P)H-hydrate dehydratase	2.3e-76	Show
1179	1856988..1858286	PP_01774; D-alanyl-D-alanine carboxypeptidase DacA	6.02e-84	Show
1180	1858375..1858458	tRNA-Leu	0.0	Show
1181	1860419..1861708	PP_01778; Decarboxylase iboD	1.68e-76	Show
1182	1865218..1875771	PP_01782; Extracellular matrix-binding protein EbhA	4.04e-14	Show
1183	1877479..1879125	PP_01786; Lipid II flippase MurJ	1.99e-89	Show
1184	1879220..1881634	PP_01787; Leucine--tRNA ligase	0.0	Show
1185	1881925..1882584	PP_01788; Phosphatidylglycerophosphatase B	4.02e-09	Show
1186	1883831..1884208	PP_01791; Cytochrome bd ubiquinol oxidase subunit 1	2.24e-18	Show
1187	1884403..1885860	PP_01792; Multidrug resistance protein 3	2.54e-74	Show
1188	1885883..1887082	PP_01793; S-adenosylmethionine synthase	1.08e-289	Show
1189	1887239..1887311	tRNA-Val	0.0	Show
1190	1887317..1887388	tRNA-Glu	0.0	Show
1191	1888294..1888384	tRNA-Ser	0.0	Show
1192	1888604..1889335	PP_01794; HTH-type transcriptional regulator CueR	1.92e-09	Show
1193	1889515..1890825	PP_01795; Guanine/hypoxanthine permease PbuG	7.46e-147	Show
1194	1891305..1892204	PP_01796; Proline iminopeptidase	2.24e-54	Show
1195	1892208..1893833	PP_01797; Dipeptide-binding protein	1.76e-81	Show
1196	1894089..1895399	PP_01798; Guanine/hypoxanthine permease PbuG	9.11e-143	Show
1197	1896068..1897696	PP_01800; Dipeptide-binding protein	6.02e-92	Show
1198	1897799..1898239	PP_01801; Uncharacterized 16.5 kDa protein in ptsI 3'region	1.15e-36	Show
1199	1898913..1900838	PP_01804; Copper-exporting P-type ATPase	4.52e-179	Show
1200	1901984..1902697	PP_01806; Uncharacterized protein M6_Spy0233	1.94e-103	Show
1201	1902713..1903366	PP_01807; Probable transcriptional regulator flp	4.51e-24	Show
1202	1904770..1906329	PP_01810; H(+)/Cl(-) exchange transporter ClcA	2.19e-50	Show
1203	1906424..1907827	PP_01811; 6-phosphogluconate dehydrogenase, decarboxylating	8.99e-154	Show
1204	1908044..1909849	PP_01812; Pyruvate oxidase	1.28e-146	Show
1205	1910208..1912106	PP_01813; tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG	0.0	Show
1206	1912119..1913504	PP_01814; tRNA modification GTPase MnmE	0.0	Show
1207	1913616..1914491	PP_01815; Membrane protein insertase YidC	7.28e-83	Show
1208	1914493..1914861	PP_01816; Ribonuclease P protein component	1.08e-81	Show
1209	1914913..1915053	PP_01817; 50S ribosomal protein L34	1.61e-24	Show
1210	1915530..1916897	PP_01818; Chromosomal replication initiator protein DnaA	2.23e-318	Show
1211	1917075..1918205	PP_01819; Beta sliding clamp	4.85e-106	Show
1212	1918430..1918654	PP_01820; Probable ribosome maturation protein RlbA	5.67e-16	Show
1213	1918654..1919781	PP_01821; DNA replication and repair protein RecF	1.47e-268	Show
1214	1919782..1921746	PP_01822; DNA gyrase subunit B	1.91e-314	Show
1215	1921757..1924231	PP_01823; DNA gyrase subunit A	0.0	Show
1216	1924432..1924728	PP_01824; 30S ribosomal protein S6	3.32e-67	Show
1217	1924762..1925292	PP_01825; Single-stranded DNA-binding protein	4.36e-61	Show
1218	1925321..1925557	PP_01826; 30S ribosomal protein S18	1.89e-48	Show
1219	1925736..1927757	PP_01827; Cyclic-di-AMP phosphodiesterase PdeA	4.83e-194	Show
1220	1927770..1928225	PP_01828; 50S ribosomal protein L9	8.43e-102	Show
1221	1928251..1929645	PP_01829; Replicative DNA helicase	1.89e-150	Show
1222	1930932..1931645	PP_01831; Protein DegV	1.87e-46	Show
1223	1931886..1932860	PP_01833; Fructokinase	1.2e-85	Show
1224	1933006..1933194	PP_01834; UPF0337 protein LJ_0034.1	6.97e-11	Show
1225	1933246..1933506	PP_01835; UPF0410 protein YwzA	5.03e-12	Show
1226	1934973..1935045	tRNA-Thr	0.0	Show
1227	1935990..1936343	PP_01838; Cadmium resistance transcriptional regulatory protein CadC	3.82e-19	Show
1228	1945847..1947247	PP_01852; Probable dipeptidase B	6.63e-159	Show
1229	1949635..1950198	PP_01855; Corrinoid adenosyltransferase	2.28e-30	Show
1230	1951142..1953376	PP_01858; Adenosylcobalamin-dependent ribonucleoside-triphosphate reductase	0.0	Show
1231	1953624..1954664	PP_01859; Putative transport protein YdbI	1.11e-69	Show
1232	1957702..1958463	PP_01864; Methionine import ATP-binding protein MetN	2.96e-32	Show
1233	1960694..1961407	PP_01867; Putative HAD-hydrolase YfnB	4.54e-39	Show
1234	1961476..1963395	PP_01868; Tetracycline resistance protein TetQ	4.37e-82	Show
1235	1963516..1964334	PP_01869; 5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YbjI	9.04e-52	Show
1236	1965579..1966592	PP_01872; D-lactate dehydrogenase	1.75e-234	Show
1237	1967196..1968023	PP_01873; Exodeoxyribonuclease	8.65e-142	Show
1238	1968083..1969525	PP_01874; Glutamate/gamma-aminobutyrate antiporter	3.6e-100	Show
1239	1969586..1971817	PP_01875; ATP-dependent RNA helicase RhlB	5.57e-06	Show
1240	1972080..1972859	16S_rRNA	0.0	Show
1241	1972892..1973863	PP_01877; D-alanyl-L-alanine endopeptidase	4.61e-25	Show
1242	1974158..1975774	PP_01878; Lipid II flippase MurJ	9.88e-58	Show
1243	1978633..1979334	PP_01882; Uncharacterized ABC transporter ATP-binding protein MJ0796	2.34e-58	Show
1244	1979423..1980733	PP_01883; PTS system N,N'-diacetylchitobiose-specific EIIC component	7.29e-10	Show
1245	1981943..1984072	PP_01885; ATP-dependent Clp protease ATP-binding subunit ClpE	3.21e-203	Show
1246	1984191..1984823	PP_01886; Signal peptidase IB	9.65e-29	Show
1247	1986313..1988517	PP_01889; PTS system beta-glucoside-specific EIIBCA component	1.0e-167	Show
1248	1988510..1989364	PP_01890; Transcription antiterminator LicT	2.25e-57	Show
1249	1990968..1991954	PP_01892; Ribose import binding protein RbsB	3.4e-89	Show
1250	1991984..1992841	PP_01893; Ribose import permease protein RbsC	4.3e-103	Show
1251	1992949..1994427	PP_01895; Ribose import ATP-binding protein RbsA	8.18e-246	Show
1252	1994443..1994838	PP_01896; D-ribose pyranase	1.43e-88	Show
1253	1994840..1995766	PP_01897; Ribokinase	1.16e-89	Show
1254	1997604..1999001	PP_01899; Putative transposase InsK for insertion sequence element IS150	8.36e-74	Show
1255	1999998..2001347	PP_01901; Amino-acid permease AapA	9.44e-149	Show
1256	2001391..2002764	PP_01902; Probable threonine/serine transporter YbxG	1.83e-168	Show
1257	2002983..2003711	PP_01903; Putative glutamine amidotransferase-like protein YvdE	8.0e-48	Show
1258	2003725..2005116	PP_01904; Uncharacterized transporter MT2031	8.89e-90	Show
1259	2005273..2005584	PP_01905; Thioredoxin-2	2.1e-05	Show
1260	2005713..2006366	PP_01907; Sulfurtransferase Alvin_2599	2.39e-06	Show
1261	2006389..2007321	PP_01908; Thioredoxin reductase	1.67e-118	Show
1262	2008762..2009505	PP_01910; Riboflavin transporter RfnT	7.08e-35	Show

Completeness (score)	intact(95)
Most Common Phage Name (# hit genes count)	PHAGE_Entero_lato_NC_001422(7) PHAGE_Entero_lato_NC_001420(5) PHAGE_Entero_Moscow/ID/2001_NC_007817(5) PHAGE_Entero_lato_NC_007856(5) PHAGE_Escher_ID52_NC_007825(5) PHAGE_Entero_alpha3_NC_001330(1) PHAGE_Escher_ID62_NC_007824(1) PHAGE_Entero_St_1_NC_012868(1) PHAGE_Entero_phiK_NC_001730(1)

Region:	The number assigned to the region.
Region Length:	The length of the sequence of that region (in bp).
Completeness:	A prediction of whether the region contains a intact or incomplete prophage based on the above criteria.
Specific Keyword:	The specific phage-related keyword(s) found in protein name(s) in the region.
Region Position:	The start and end positions of the region on the bacterial chromosome.
# tRNA + rRNA + tmRNA:	The number of tRNA, rRNA and tmRNA genes present in the region.
# Total Proteins:	The number of ORFs present in the region.
# Phage Hit Proteins:	The number of proteins in the region with matches in the phage protein database.
# Hypothetical Proteins:	The number of hypothetical proteins in the region without a match in the database.
Phage + Hypothetical Protein %:	The combined percentage of phage proteins and hypothetical proteins in the region.
# Bacterial Proteins:	The number of proteins in the region with matches in the nrfilt database.
Attachment Site:	The putative phage attachment site.
# Phage Species:	The number of different phages that have similar proteins to those in the region.
Most Common Phage:	The phage(s) with the highest number of proteins most similar to those in the region.
First Most Common Phage #:	The highest number of proteins in a phage most similar to those in the region.
First Most Common Phage %:	The percentage of proteins in # Phage Hit Proteins that are most similar to the Most Common Phage proteins.
GC %:	The percentage of GC nucleotides of the region.